Thrombin Induces the Activation of Progelatinase A in Vascular Endothelial Cells

Abstract

Angiogenesis requires degradation of vascular basement membrane prior to migration and proliferation of endothelial cells; proteinases are essential ingredients in this process. Because of thrombin's multiple effects on endothelium, we have examined its role in matrix metalloproteinase activation using human umbilical vein endothelial cells. Gelatin zymography of endothelial conditioned media revealed a prominent 72-kDa progelatinase A band. Addition of ␣-thrombin to endothelial cells resulted in the generation of 64 and 62 kDa gelatinolytic bands which is consistent with the activation of progelatinase A; thrombin had no effect in the absence of cells. This effect requires the proteolytic site of thrombin since progelatinase A activation was abolished by specific inhibitors of thrombin. Matrix metalloproteinase inhibitors diminished thrombin-induced activation of progelatinase A. Pretreatment of endothelial cells with excess tissue inhibitor of metalloproteinase-2 or a COOH-terminal fragment of progelatinase A abrogated thrombin-mediated activation of progelatinase A presumably by competing with the COOH terminus of native progelatinase A for interaction with an activator site on endothelial plasma membranes. Although membrane-type matrix metalloproteinase was demonstrated in endothelial cells by Northern and Western blotting, the receptor function of this molecule in thrombin-induced activation of progelatinase A needs to be clarified. Progelatinase A activation did not require intracellular signal transduction events mediated by the thrombin receptor. These data demonstrate that 1) endothelial cells express a novel activation mechanism for progelatinase A, 2) proteolytically active thrombin regulates this activation mechanism, and 3) activation occurs independently of the functional thrombin receptor.Whereas the effect of thrombin (EC 3.4.21.5) on production of fibrin and activation of platelets has been intensively studied over many years, interest in the role of thrombin on endothelial function has lagged. Recent studies have indicated that thrombin affects post-clotting events involved in angiogenesis (1). The vascular endothelium actively binds coagulation proteins, resulting in cell-surface generation of thrombin that can persist within the protected environment of a clot (2). A unique Gprotein-coupled thrombin receptor (3) is known to be functionally expressed by endothelial cells (4). Interaction of thrombin with an endothelial cell-surface thrombin receptor(s) results in a multiplicity of effects including cell retraction and permeability, generation of phosphoinositides and prostaglandin, and secretion of Von Willebrand factor, tissue plasminogen activator, and platelet-derived growth factor (5-7). The role of individual thrombin receptors and endothelial signal transduction events on thrombin-mediated cell activation phenomena remain incompletely characterized (4).Neoangiogenesis, the formation of new blood vessels from preexisting vessels, requires the degradation of underlying basement membranes p...

Distinct Roles for the Catalytic and Hemopexin Domains of Membrane Type 1-Matrix Metalloproteinase in Substrate Degradation and Cell Migration

“…Construction of Plasmids-Expression vectors including MT1-MMP, TIMP-1, -2, pMMP-2, and soluble MT1-MMP (sol.MT1) without transmembrane and cytoplasmic domains have been described in detail previously (18,21,22). MT⌬C lacking the cytoplasmic domain of MT1-MMP was generated by introducing a stop codon after Phe 562 based on a PCR strategy using the primer sets: forward primer, number 1563: 5Ј-3Ј: CACGAATTCCGGACCATGTCTCCCGCCCCAAGA and reverse primer, number 1929: 5Ј-3Ј: AAGAATTCTCAGAAGAAGAAGACTGC-AAG.…”

The Propeptide Domain of Membrane Type 1-Matrix Metalloproteinase Acts as an Intramolecular Chaperone when Expressed in transwith the Mature Sequence in COS-1 Cells

“…The monoclonal antibody to hemagglutinin (HA) tag was purchased from Roche Molecular Biochemicals (clone 12 CA5). Rabbit polyclonal antibodies to a synthetic peptide (CDGNFDTVAMLRGEM) within the catalytic domain (10), to the hinge region of MT1-MMP (Chemicon International, Temecula, CA), and to the prodomain of MT1-MMP (Chemicon) were employed. Recombinant progelatinase A, produced by COS-1 cells transfected with gelatinase A cDNA, was purified as described previously (2, 7).…”

“…Gelatin Substrate Zymography and Western Blotting-Basic protocols for these techniques have been described in our recent papers (4,7,10). Western blotting for proteins Ͻ15 kDa was done using a modification of the tricine-SDS method involving 0.1 M tricine, 0.1% SDS, pH 8.25, in a cathode buffer and 0.2 M Tris, pH 8.9, in the anode buffer (14).…”

Role and regulation of the thrombin receptor (PAR-1) in human melanoma

“…Activation of the thrombin receptor in a variety of cell types can elicit a range of cellular responses and expression of thrombin-responsive genes. Many of the gene products are precisely those that would be required for angiogenesis and tumor invasion, including IL-8 (Ueno et al, 1996), VEGF , bFGF (Cucina et al, 1999), PDGF (Shimizu et al, 2000), MMP-2 (Zucker et al, 1995), uPA (Yoshida et al, 1994) alpha IIb beta 3, alpha v beta 3, and alpha v beta 5 integrins (Wojtukiewicz et al, 1992;Senger et al, 1996;Even-Ram et al, 2001). This suggests that activation of the thrombin receptor may facilitate tumor invasion and metastasis through the induction of cell adhesion molecules, matrix-degrading proteases, and stimulating the secretion of angiogenic factors, thus contributing to the metastatic phenotype of melanoma.…”