Tick Acquisition of
            <i>Ehrlichia canis</i>
            from Dogs Treated with Doxycycline Hyclate

Schaefer, John J.; Needham, Glen R.; Bremer, William G.; Rikihisa, Yasuko; Ewing, S. A.; Stich, Roger W.

doi:10.1128/aac.00358-07

Cited by 33 publications

(30 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…E. canis infections were detected in peripheral blood and in Rhipicephalus sanguineus ticks acquisition fed as nymphs after a 14-day doxycycline regimen from dogs that were infected by tick transmission that resulted in mild acute-phase CME (43). Conversely, E. canis infections were not detected in peripheral blood after a 28-day doxycycline regimen from dogs that were infected by intravenous inoculation of carrier blood that resulted in severe acute-phase CME (42).…”

mentioning

confidence: 80%

“…A p30-based PCR assay was used to test for the presence of E. canis DNA as previously described elsewhere, with some modifications (6,35,42,43,47). Briefly, 25-l reaction mixtures were prepared with 2% dimethyl sulfoxide (DMSO), 2.0 mM MgCl 2 , 200 M of each deoxynucleoside triphosphate (dNTP), 0.3 M (each) of primers ECA30-384S (ATAAACACGCTGACTTT ACTGTTCC) and ECA30-583A (GTGATGAGATAGAGCGCAGTACC), and 0.03 U/l of Platinum Taq polymerase (Invitrogen, Carlsbad, CA).…”

Section: Methodsmentioning

confidence: 99%

“…Several reports suggested that E. canis infections can persist in dogs treated with doxycycline during postacute phases of CME (23,29,43,58). Thus, the working hypothesis for this experiment was that the initiation of a 28-day doxycycline regimen during the subclinical phase of experimental CME would result in less efficacious elimination of E. canis infections than treatment during the acute phase of the disease.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Efficacy of a Doxycycline Treatment Regimen Initiated during Three Different Phases of Experimental Ehrlichiosis

McClure

Crothers

Schaefer

et al. 2010

Antimicrob Agents Chemother

Self Cite

View full text Add to dashboard Cite

Doxycycline is the treatment of choice for canine monocytic ehrlichiosis (CME), a well-characterized disease and valuable model for tick-borne zoonoses. Conflicting reports of clearance of Ehrlichia canis after treatment with doxycycline suggested that the disease phase during which treatment is initiated influences outcomes of these treatments. The purpose of this study was to evaluate the efficacy of a 28-day doxycycline regimen for clearance of experimental E. canis infections from dogs treated during three phases of the disease. Ten dogs were inoculated with blood from E. canis carriers and treated with doxycycline during acute, subclinical, or chronic phases of CME. Daily rectal temperatures and semiweekly blood samples were monitored from each dog, and Rhipicephalus sanguineus ticks were acquisition fed on each dog for xenodiagnosis. Blood collected from dogs treated during acute or subclinical CME became PCR negative for E. canis as clinical parameters improved, but blood samples collected from dogs treated during chronic CME remained intermittently PCR positive. R. sanguineus ticks fed on dogs after doxycycline treatments became PCR positive for E. canis, regardless of when treatment was initiated. However, fewer ticks became PCR positive after feeding on two persistently infected dogs treated with doxycycline followed by rifampin, suggesting that antibiotic therapy can reduce tick acquisition of E. canis.

show abstract

mentioning

confidence: 80%

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Efficacy of a Doxycycline Treatment Regimen Initiated during Three Different Phases of Experimental Ehrlichiosis

McClure

Crothers

Schaefer

et al. 2010

Antimicrob Agents Chemother

Self Cite

View full text Add to dashboard Cite

show abstract

“…The chronic stage resembles the acute phase with recurrent clinical symptoms which may be mild or severe. Doxycycline is effective in alleviating the clinical symptoms of CME but does not appear to clear the infection in all dogs successfully (Skotarczak 2003;Schaefer et al 2007). Infection of dogs in Canada with E. canis is considered relatively rare, with a seroprevalence of 0.37% detected by Gary et al (2006).…”

Section: Tick-borne Relapsing Fevermentioning

confidence: 99%

The Biological Survey of Canada: A Personal History

Danks¹

2017

View full text Add to dashboard Cite

“…Em um estudo 10 , infecções apareceram mais resistentes quando o tratamento foi iniciado durante a fase aguda (16 dpi) do que quando iniciado durante a fase subclínica (62 dpi). Em um estudo anterior, o regime de 14 dias de tratamento com doxiciclina não eliminou a E. canis de cães 10 , indicando que o regime de 28 dias é necessário 11 . Há evidências de que a E. canis pode persistir após o tratamento de doxiciclina de hospedeiros infectados naturalmente 1,8,12 .…”

unclassified

Azitromicina no tratamento da erlichiose monocítica em cães naturalmente infectados

2014

View full text Add to dashboard Cite

RESUMOOs objetivos deste trabalho foram avaliar a eficácia do tratamento com azitromicina em cães naturalmente infectados por E. canis e acompanhar a evolução clínico-hematológica dos animais. Dez cães, com diagnóstico positivo para E. canis por meio do teste de Elisa Snap 4Dx, foram distribuídos em dois grupos, sem tratamento e tratados com azitromicina, 20 mg/kg, via oral, uma vez ao dia, durante sete dias. Além do exame físico diário foram realizados hemogramas, esfregaços de ponta de orelha para a pesquisa de mórulas e nested PCR antes do tratamento e pós-tratamento. Verificou-se que o tratamento não foi eficiente, uma vez que não desapareceram os sinais clínicos, assim como não houve retorno à normalidade dos valores do hemograma nos cães, assim como ausência de eliminação de E. canis. -------------------------Palavras-chave: Azitromicina; Ehrlichia canis; PCR; Cães. AZITHROMYCIN IN THE TREATMENT OF MONOCYTIC EHRLICHIOSIS IN NATURALLY INFECTED DOGS ABSTRACTThe aims of this study were to evaluate the effectiveness of treatment with azithromycin in dogs naturally infected with E. canis, and to analyse the clinical and hematological changes the animals would show. Ten dogs with positive diagnosis for E. canis through Elisa Snap 4Dx test were distributed into two groups, untreated and treated with azithromycin, 20 mg/kg, orally once a day for seven days. In addition to the physical exam, complete blood counts (CBC), smears made out from blood of the ear margin in order to detect ehrlichial morulae and nested PCR before treatment and post-treatment were performed. We found that the treatment was not effective, since the clinical signs did not disappear, as well as there was no return to normal values of the CBC in treated animas, neither the elimination of E. canis from the infected animals.-----------------------

show abstract

Tick Acquisition of Ehrlichia canis from Dogs Treated with Doxycycline Hyclate

Cited by 33 publications

References 16 publications

Efficacy of a Doxycycline Treatment Regimen Initiated during Three Different Phases of Experimental Ehrlichiosis

Efficacy of a Doxycycline Treatment Regimen Initiated during Three Different Phases of Experimental Ehrlichiosis

The Biological Survey of Canada: A Personal History

Azitromicina no tratamento da erlichiose monocítica em cães naturalmente infectados

Contact Info

Product

Resources

About