Tissue (re)distribution of Trypanosoma equiperdum in venereal infected and blood transfused horses

Yasine, Ahmed; Daba, Merga; Ashenafi, Hagos; Geldhof, Peter; Brantegem, Leen Van; Vercauteren, Griet; Demissie, Tilaye; Bekana, M.; Alemu, Tekie; Soom, Ann Van; Duchateau, Luc; Goddeeris, Bruno; Govaere, Jan

doi:10.1016/j.vetpar.2019.03.007

Cited by 6 publications

(7 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Histopathologically, the uterine lesions observed are in consonance with reports of horses naturally infected with Τrypanosoma equiperdum [15], heifers infected with T. congolense [8], and goats infected with T. brucei [50]. These inflammatory and degenerative changes may cause infertility, embryonic death, and abortion in pregnant cows, as stated by Ogwu and Njoku [8], Leigh et al [50], Jones et al [55], Mcentee [56].…”

Section: Discussionsupporting

confidence: 85%

“…Several studies show that trypanosomosis cause a wide range of reproductive disorders in animals, as well as degeneration of the gonads with consequent disruptions in the secretions and plasma levels of the hormones necessary for normal reproductive processes in both male and female animals [8][9][10][11][12][13][14][15]. Genital abnormalities that have been observed in female animals included anestrus, irregular estrus cycles, low birth weight, stillbirth, neonatal death, abortion, and premature birth [16][17][18][19] and were associated with vertical transmission through the placenta [20,21].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Genital lesions in cows naturally infected with trypanosomes in Abuja, Nigeria

et al. 2021

View full text Add to dashboard Cite

Background and Aim: Different species of trypanosomes have been reported to cause varying degrees of reproductive disorders in pregnant and non-pregnant animals under experimental infections. Information on reproductive disorders and losses in animals naturally infected with trypanosome species are few. This study was carried out to assess the abnormalities in the genital organs (ovaries, oviduct, uterus, cervix, and vagina) of female cattle naturally infected with trypanosomes in and around Abuja, Nigeria. Materials and Methods: Cows showing signs such as emaciation, weakness, or anemia were selected and examined at Gwagwalada and Karu abattoirs, respectively. Venous blood samples were taken from 108 of such animals and screened using standard trypanosome detection methods. The genital organs were also collected and inspected for gross and histopathological lesions in the laboratory. Results: Six (5.55%) out of the 108 animals were positive for trypanosomes; 4 (66.7%) were infected with Trypanosoma vivax and 2 (33.3%) were infected with Trypanosoma congolense. The mean packed cell volume of the infected animals was 22.83%. Grossly, congestion and ecchymotic hemorrhages were observed in the endometrium, myometrium, and cervical submucosa. Mucometra, hydrometra, and pyometra were also seen in the uterus. Histologically, necrosis of the epithelium and endometrial glands accompanied by mononuclear cellular infiltration was observed in the uterus. There was also sloughing of the endometrial epithelium, vascular congestion, and hypertrophy of serosa of the uterus. There was atropy of the granulosa cells, increased numbers of degenerating tertiary follicles, and absence of corpora lutea in the ovary. No gross or histopathological lesions were observed in the fallopian tube and vagina. Conclusion: The lesions observed were restricted to the uterus and ovary of the animals and were less severe when compared to lesions observed under experimental conditions as reported by previous authors.

show abstract

Section: Discussionsupporting

confidence: 85%

Section: Introductionmentioning

confidence: 99%

Genital lesions in cows naturally infected with trypanosomes in Abuja, Nigeria

et al. 2021

View full text Add to dashboard Cite

show abstract

“…The DNA samples were tested by real-time PCR targeting the internal transcribed spacer regions (ITS1) of trypanosomes with forward primer 5’TGTAGGTGAACCTGCAGCTGGATC3’ and reverse primer 5’CCAAGTCATCCATCGCGACACGTT3’ [26] resulting in fragments of approximately 450 bp [26, 27]. The method was done on a Step One Plus Real-Time PCR System (Life Technologies) following detailed procedures of our previous work [53]. Samples were considered positive when the observed amplification and melting curve are similar to positive control and negative samples are also included (Fig.…”

Section: Methodsmentioning

confidence: 99%

Histopathological lesions in reproductive organs, distal spinal cord and peripheral nerves of horses naturally infected with Trypanosoma equiperdum

et al. 2019

Self Cite

View full text Add to dashboard Cite

Background Dourine, a venereal transmitted trypanosomosis caused by Trypanosoma equiperdum , has different clinical signs related to the reproductive and nervous system. Pathologic tissue changes associated with the disease are poorly described. The present study describes the histopathological lesions in naturally T. equiperdum -infected horses in the chronical stage of dourine. Results Four chronically dourine diseased horses underwent a post-mortem examination. They were Woo test negative, but CATT /T. evansi positive, had a low packed cell volume (PCV) and exhibited obvious clinical signs of dourine. Post-mortem examination did not reveal gross lesions in the organs assumed to be responsible for the symptomatology. On histopathology, genital organs were affected, with mononuclear cell infiltration and erosions and degeneration of seminiferous tubules and perivascular lymphoplasmacytic cuffing in the uterus. In the nervous system, mononuclear cell infiltration was located in peripheral nerves, ganglia and in the spinal cord, leading to axonal degeneration. Real-time PCR using ITS primer revealed the presence of trypanosomes in these organs and conventional PCRs using maxicircle and RoTat1.2 primers further confirmed the involvement of T. equiperdum since the DNAs from the vagina, testicle, distal spinal cord, sciatic and obturator nerves found to be positive for maxicircle and negative for RoTat 1.2. Conclusions The histopathological lesions in the spinal cord and peripheral nerves explain the incoordination of the hind legs in T. equiperdum -infected horses, whilst its presence in the genital tract exemplifies the venereal transmission.

show abstract

“…These mouse infection models have been utilized in pathological and immunological studies to elucidate the pathogenesis of trypanosomiasis [1]. Dourine, one of the trypanosomiasis in equids, is caused by infection with T. equiperdum [7,12,24]. Infected horses manifest various clinical signs, such as edema of the external genitalia, skin plaques, and neurological signs during the long-term clinical course of 1-2 months to several years [12].…”

Section: Introductionmentioning

confidence: 99%

“…Infected horses manifest various clinical signs, such as edema of the external genitalia, skin plaques, and neurological signs during the long-term clinical course of 1-2 months to several years [12]. Pathological examinations of infected horses revealed that these clinical signs are caused by inflammation and edema of the genital organs, dermatitis, and peripheral polyneuritis, respectively [10,13,20,24]. However, the pathogenesis of dourine remains largely unknown.…”

Section: Introductionmentioning

confidence: 99%

Pathology of female mice experimentally infected with an <i>in vitro</i> cultured strain of <i>Trypanosoma equiperdum</i>

Tanaka

Suganuma

Watanabe

et al. 2021

The Journal of Veterinary Medical Science

View full text Add to dashboard Cite

Dourine, caused by infection with Trypanosoma equiperdum, is one of the trypanosomiasis in equids. The clinical course of dourine is long-term, ranging from 1-2 months to several years. Since the pathogenesis of dourine has not yet been elucidated, experimental studies using mouse infection models are needed. Although mice are not susceptible to most T. equiperdum strains, some strains can infect mice. Even in such strains, infected mice develop rapidly transient parasitemia and die within 2-8 days.Therefore, mice experimentally infected with these T. equiperdum strains are not suitable for mouse infection models to analysis the pathogenesis of dourine. A sequential method of isolating parasites from dourine-affected horses and adapting them to in vitro cultures using soft agarose media was recently developed. Various T. equiperdum strains adapted to in vitro conditions have been established using this technique. We used one of these strains, the T. equiperdum IVM-t2 strain. In the present study, T. equiperdum IVM-t2 strain inoculated mice developed periodic parasitemia during the experimental period of 60 days. Histopathologically, vaginitis and dermatitis were observed. These findings were comparable to those of dourine-affected horses. Therefore, mice infected with T. equiperdum IVM-t2 strain may be a valuable tool for pathological, immunological, and parasitological in vivo research, and will contribute to investigations on the mechanisms underlying the disease process and the host-parasite relationship.

show abstract

Tissue (re)distribution of Trypanosoma equiperdum in venereal infected and blood transfused horses

Cited by 6 publications

References 35 publications

Genital lesions in cows naturally infected with trypanosomes in Abuja, Nigeria

Genital lesions in cows naturally infected with trypanosomes in Abuja, Nigeria

Histopathological lesions in reproductive organs, distal spinal cord and peripheral nerves of horses naturally infected with Trypanosoma equiperdum

Pathology of female mice experimentally infected with an <i>in vitro</i> cultured strain of <i>Trypanosoma equiperdum</i>

Contact Info

Product

Resources

About