TnMax — a versatile mini-transposon for the analysis of cloned genes and shuttle mutagenesis

Haas, Rainer; Kahrs, Andreas F.; Facius, Dirk; Allmeier, Helmut; Schmitt, Rüdiger; Meyer, Thomas F.

doi:10.1016/0378-1119(93)90342-z

Cited by 96 publications

(83 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…pylori strain P1 (20) was grown on 3.6% GC agar plates (Oxoid), supplemented with 1% Isovital (Biological Laboratories) and 10% horse serum (Biological industries) and maintained in a microaerophilic atmosphere (85% N 2 , 10% CO 2 , 5% O 2 ) at 37°C for 48 h.…”

Section: Methodsmentioning

confidence: 99%

GroEL ofLactobacillus johnsoniiLa1 (NCC 533) Is Cell Surface Associated: Potential Role in Interactions with the Host and the Gastric PathogenHelicobacter pylori

et al. 2006

View full text Add to dashboard Cite

Heat shock proteins of the GroEL or Hsp60 class are highly conserved proteins essential to all living organisms. Even though GroEL proteins are classically considered intracellular proteins, they have been found at the surface of several mucosal pathogens and have been implicated in cell attachment and immune modulation. The purpose of the present study was to investigate the GroEL protein of a gram-positive probiotic bacterium, Lactobacillus johnsonii La1 (NCC 533). Its presence at the bacterial surface was demonstrated using a whole-cell enzyme-linked immunosorbent assay and could be detected in bacterial spent culture medium by immunoblotting. To assess binding of La1 GroEL to mucins and intestinal epithelial cells, the La1 GroEL protein was expressed in Escherichia coli. We report here that La1 recombinant GroEL (rGroEL) binds to mucins and epithelial cells and that this binding is pH dependent. Immunomodulation studies showed that La1 rGroEL stimulates interleukin-8 secretion in macrophages and HT29 cells in a CD14-dependent mechanism. This property is common to rGroEL from other gram-positive bacteria but not to the rGroEL of the gastric pathogen Helicobacter pylori. In addition, La1 rGroEL mediates the aggregation of H. pylori but not that of other intestinal pathogens. Our in vitro results suggest that GroEL proteins from La1 and other lactic acid bacteria might play a role in gastrointestinal homeostasis due to their ability to bind to components of the gastrointestinal mucosa and to aggregate H. pylori.

show abstract

Section: Methodsmentioning

confidence: 99%

GroEL ofLactobacillus johnsoniiLa1 (NCC 533) Is Cell Surface Associated: Potential Role in Interactions with the Host and the Gastric PathogenHelicobacter pylori

et al. 2006

View full text Add to dashboard Cite

show abstract

“…TBLASTN and BLASTN were also used. The locations of transposon insertions were determined by amplifying the area of interest and sequencing parts of the amplicon by initiating DNA sequencing reactions from the TnMax2 transposon (19) with the primers AAACATGCAGGAATTG ACGA and TTCCTGAGCCGATTTCAAAG. Mutant 304-2 was genetically complemented by introducing DNA cloned into the kanamycin resistance, broad-host-range plasmid pDSK519 (23).…”

Section: Strainsmentioning

confidence: 99%

“…The resulting amplicon was 1,315 bp. The two recombinant clones were digested with XhoI and joined to an erythromycin resistance cassette (19) that was engineered to contain flanking XhoI sites by PCR amplification using the primers EmXhoF, CTCGAGTGAATCGTTAATAAGCAAAATTC, and EmXhoR, CTC GAGTTAAGGGATGCAGTTTATGC. The replacement of pdpD by the erythromycin cassette was verified by using PCR with three pdpD primer sets to show that pdpD was absent and combining primers for the erythromycin cassette with primers that hybridize to DNA flanking pdpD to generate amplicons.…”

mentioning

confidence: 99%

A Francisella tularensis Pathogenicity Island Required for Intramacrophage Growth

et al. 2004

View full text Add to dashboard Cite

Francisella tularensis is a gram-negative, facultative intracellular pathogen that causes the highly infectious zoonotic disease tularemia. We have discovered a ca. 30-kb pathogenicity island of F. tularensis (FPI) that includes four large open reading frames (ORFs) of 2.5 to 3.9 kb and 13 ORFs of 1.5 kb or smaller. Previously, two small genes located near the center of the FPI were shown to be needed for intramacrophage growth. In this work we show that two of the large ORFs, located toward the ends of the FPI, are needed for virulence. Although most genes in the FPI encode proteins with amino acid sequences that are highly conserved between high-and low-virulence strains, one of the FPI genes is present in highly virulent type A F. tularensis, absent in moderately virulent type B F. tularensis, and altered in F. tularensis subsp. novicida, which is highly virulent for mice but avirulent for humans. The G؉C content of a 17.7-kb stretch of the FPI is 26.6%, which is 6.6% below the average G؉C content of the F. tularensis genome. This extremely low G؉C content suggests that the DNA was imported from a microbe with a very low G؉C-containing chromosome.

show abstract

“…For the insertional mutagenesis of the other genes studied here (see Tables S1 and S2 in the supplemental material), a ϳ1-kb fragment of the gene of interest was PCR amplified from DNA from H. mustelae strain NCTC 12198 by using knockout (KO) primers (Table S2). The amplicons were cloned into the pGEM-T Easy vector (Promega), and the cloned sequences were interrupted by the insertion of an antibiotic resistance cassette obtained from plasmids pJMK30 (kanamycin), pAV35 (chloramphenicol), and pDH20 (erythromycin) (16,40). The antibiotic resistance cassettes were inserted into unique restriction sites in the cloned fragments: BglII for tonB1, tonB2, nixA, and ceuE; BclI for frpB1; EcoRV for frpB2 and fecA; KpnI for cfrA; HindIII for feoB; and Eco47III for fecD.…”

mentioning

confidence: 99%

An ABC Transporter and a TonB Ortholog Contribute to Helicobacter mustelae Nickel and Cobalt Acquisition

et al. 2010

View full text Add to dashboard Cite

The genomes of Helicobacter species colonizing the mammalian gastric mucosa (like Helicobacter pylori) contain a large number of genes annotated as iron acquisition genes but only few nickel acquisition genes, which contrasts with the central position of nickel in the urease-mediated acid resistance of these gastric pathogens. In this study we have investigated the predicted iron and nickel acquisition systems of the ferret pathogen Helicobacter mustelae. The expression of the outer membrane protein-encoding frpB2 gene was iron and Fur repressed, whereas the expression of the ABC transporter genes fecD and ceuE was iron and Fur independent. The inactivation of the two tonB genes showed that TonB1 is required for heme utilization, whereas the absence of TonB2 only marginally affected iron-dependent growth but led to reduced cellular nickel content and urease activity. The inactivation of the fecD and ceuE ABC transporter genes did not affect iron levels but resulted in significantly reduced urease activity and cellular nickel content. Surprisingly, the inactivation of the nixA nickel transporter gene affected cellular nickel content and urease activity only when combined with the inactivation of other nickel acquisition genes, like fecD or ceuE. The FecDE ABC transporter is not specific for nickel, since an fecD mutant also showed reduced cellular cobalt levels and increased cobalt resistance. We conclude that the H. mustelae fecDE and ceuE genes encode an ABC transporter involved in nickel and cobalt acquisition, which works independently of the nickel transporter NixA, while TonB2 is required primarily for nickel acquisition, with TonB1 being required for heme utilization.

show abstract

TnMax — a versatile mini-transposon for the analysis of cloned genes and shuttle mutagenesis

Cited by 96 publications

References 23 publications

GroEL ofLactobacillus johnsoniiLa1 (NCC 533) Is Cell Surface Associated: Potential Role in Interactions with the Host and the Gastric PathogenHelicobacter pylori

GroEL ofLactobacillus johnsoniiLa1 (NCC 533) Is Cell Surface Associated: Potential Role in Interactions with the Host and the Gastric PathogenHelicobacter pylori

A Francisella tularensis Pathogenicity Island Required for Intramacrophage Growth

An ABC Transporter and a TonB Ortholog Contribute to Helicobacter mustelae Nickel and Cobalt Acquisition

Contact Info

Product

Resources

About