Toll-interacting protein (Tollip) negatively regulates pressure overload-induced ventricular hypertrophy in mice

Liu, Yi; Jiang, Xiao Li; Liu, Yu; Jiang, Dan; Zhang, Yan; Zhang, Rui; Chen, Yingjie; Yang, Qinglin; Zhang, Xiao Dong; Fan, Guo-Chang; Li, Hongliang

doi:10.1093/cvr/cvt232

Cited by 46 publications

(44 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…By contrast, the expression level of Tollip was nearly depleted by the late phase of vascular repair. This phenomenon is consistent with previous findings that Tollip levels are significantly elevated by acute stimuli, such as myocardial infarction, but are attenuated in a chronic pressure overload model 9, 10. However, the precise regulatory mechanism of Tollip expression was not clarified in the present study; therefore, additional experiments are still required to decipher it.…”

Section: Discussionsupporting

confidence: 91%

“…Because Akt plays a critical role in the pathophysiology of VSMC remodeling and the capacity of Tollip to modulate adverse cardiac remodeling through Akt‐dependent pathways have been established,8, 9, 10, 22, 23 we hypothesized that Akt might also be required for the regulatory effects of Tollip on neointima formation. Western blotting was then performed to delineate the expression and phosphorylation of Akt and its downstream molecules, including GSK3β and FOXO3A, in LCAs from each group.…”

Section: Resultsmentioning

confidence: 99%

“…As a well‐established signaling cascade that participates in intimal hyperplasia, Akt signaling is also a downstream pathway of Tollip in cardiovascular disease 8, 9, 10, 22, 23. Therefore, we investigated the status of the Akt‐dependent signaling pathway in response to vascular injury.…”

Section: Discussionmentioning

confidence: 99%

“…The Tollip‐TG mice were identified using the primers 5′‐CCTTCCAGTCCACAAACGAC‐3′ and 5′‐ATCATGCCCTCCTTGTCATC‐3′. The generation of the Tollip‐KO mice and the Tollip‐KO rats was described previously 9, 10…”

Section: Methodsmentioning

confidence: 99%

“…Furthermore, recent evidence has revealed that Tollip is involved in cardiovascular diseases, including cardiac remodeling after chronic pressure overload and myocardial infarction 8, 9, 10. Tollip can physically associate with TLR2 and TLR4 to suppress TLR signaling 11.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Tollip Negatively Regulates Vascular Smooth Muscle Cell–Mediated Neointima Formation by Suppressing Akt‐Dependent Signaling

Huang

Gong

Cheng

et al. 2018

JAHA

Self Cite

View full text Add to dashboard Cite

BackgroundTollip, a well‐established endogenous modulator of Toll‐like receptor signaling, is involved in cardiovascular diseases. The aim of this study was to investigate the role of Tollip in neointima formation and its associated mechanisms.Methods and ResultsIn this study, transient increases in Tollip expression were observed in platelet‐derived growth factor‐BB–treated vascular smooth muscle cells and following vascular injury in mice. We then applied loss‐of‐function and gain‐of‐function approaches to elucidate the effects of Tollip on neointima formation. While exaggerated neointima formation was observed in Tollip‐deficient murine neointima formation models, Tollip overexpression alleviated vascular injury–induced neointima formation by preventing vascular smooth muscle cell proliferation, dedifferentiation, and migration. Mechanistically, we demonstrated that Tollip overexpression may exert a protective role in the vasculature by suppressing Akt‐dependent signaling, which was further confirmed in rescue experiments using the Akt‐specific inhibitor (AKTI).ConclusionsOur findings indicate that Tollip protects against neointima formation by negatively regulating vascular smooth muscle cell proliferation, dedifferentiation, and migration in an Akt‐dependent manner. Upregulation of Tollip may be a promising strategy for treating vascular remodeling–related diseases.

show abstract

Section: Discussionsupporting

confidence: 91%

Section: Resultsmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Tollip Negatively Regulates Vascular Smooth Muscle Cell–Mediated Neointima Formation by Suppressing Akt‐Dependent Signaling

Huang

Gong

Cheng

et al. 2018

JAHA

Self Cite

View full text Add to dashboard Cite

show abstract

The Akt pathway mediates the protective effects of myeloid differentiation protein 1 in pathological cardiac remodelling

et al. 2021

View full text Add to dashboard Cite

Aims Myeloid differentiation protein 1 (MD1) was shown to ameliorate pressure overload-induced cardiac hypertrophy and fibrosis by negatively regulating the MEK-ERK1/2 and NF-κB pathways. However, whether MD1 modulates cardiac function and whether the Akt pathway mediates the benefits of MD1 in pressure overload-induced cardiac remodelling remain unclear. Methods and Results Male cardiac-specific transgenic MD1 (MD1-TG) mice, MD1-knockout (KO) mice and wild-type (WT) littermates aged 8-10 weeks were subjected to sham operation and aortic banding (AB) for 4 weeks. Then, left ventricular (LV) hypertrophy, fibrosis and function of the mice were assessed. When compared with WT-AB mice, MD1-TGs showed decreased cross-sectional area (CSA) of cardiomyocytes (P < 0.001), mRNA expression of β-myosin heavy chain (β-MHC) (P < 0.02), ratios of heart weight/body weight and heart weight/tibia length (P < 0.04) and collagen volume fraction (P < 0.001). The LV end-diastolic diameter was reduced, and LV ejection fraction and fractional shortening were improved in MD1-TG-AB mice than in WT-AB mice (P < 0.05). In cultured H9C2 cells, adenovirus vector-mediated MD1 overexpression decreased angiotensin II-induced mRNA expression of brain natriuretic peptide (BNP) and β-MHC and cell CSA (P < 0.002), whereas knockdown of MD1 by shRNA exhibited opposite effects (P < 0.04). Mechanistically, MD1 suppressed pathological cardiac remodelling at least partly by blocking Akt pathway. Akt inactivation by MK2206 largely offset the pro-hypertrophic effects of MD1 deficiency in angiotensin II-stimulated cardiomyocytes. Conclusions The Akt pathway mediates the protective effects of MD1 in pressure overload-induced cardiac remodelling in mice. Targeting MD1 may provide therapeutic strategy for the treatment of pathological cardiac remodelling and heart failure.

show abstract

Tollip is a critical mediator of cerebral ischaemia–reperfusion injury

Feng

Wang

et al. 2015

The Journal of Pathology

Self Cite

View full text Add to dashboard Cite

Toll-like receptor (TLR) signalling plays an important role in regulating cerebral ischaemia-reperfusion (I/R) injury. Toll-interacting protein (Tollip) is an endogenous negative modulator of TLR signalling that is involved in several inflammatory diseases. Our previous study showed that Tollip inhibits overload-induced cardiac remodelling. However, the role of Tollip in neurological disease remains unknown. In the present study, we proposed that Tollip might contribute to the progression of stroke and confirmed this hypothesis. We found that Tollip expression was significantly increased in I/R-challenged brain tissue of humans, mice and rats in vivo and in primary neurons subjected to oxygen and glucose deprivation in vitro, indicating the involvement of Tollip in I/R injury. Next, using genetic approaches, we revealed that Tollip deficiency protects mice against I/R injury by attenuating neuronal apoptosis and inflammation, as demonstrated by the decreased expression of pro-apoptotic and pro-inflammatory genes and the increased expression of anti-apoptotic genes. By contrast, neuron-specific Tollip over-expression exerted the opposite effect. Mechanistically, the detrimental effects of Tollip on neuronal apoptosis and inflammation following I/R injury were largely mediated by the suppression of Akt signalling. Additionally, to further support our findings, a Tollip knockout rat strain was generated via CRISPR-Cas9-mediated gene inactivation. The Tollip-deficient rats were also protected from I/R injury, based on dramatic decreases in neuronal apoptosis and ischaemic inflammation through Akt activation. Taken together, our findings demonstrate that Tollip acts as a novel modulator of I/R injury by promoting neuronal apoptosis and ischaemic inflammation, which are largely mediated by suppression of Akt signalling.

show abstract

Toll-interacting protein (Tollip) negatively regulates pressure overload-induced ventricular hypertrophy in mice

Abstract: Our results provide the first evidence that Tollip serves as a negative regulator of pathological cardiac hypertrophy by blocking the AKT signalling pathway.

Cited by 46 publications

References 33 publications

Tollip Negatively Regulates Vascular Smooth Muscle Cell–Mediated Neointima Formation by Suppressing Akt‐Dependent Signaling

Tollip Negatively Regulates Vascular Smooth Muscle Cell–Mediated Neointima Formation by Suppressing Akt‐Dependent Signaling

The Akt pathway mediates the protective effects of myeloid differentiation protein 1 in pathological cardiac remodelling

Tollip is a critical mediator of cerebral ischaemia–reperfusion injury

Contact Info

Product

Resources

About