Toll-like Receptor 2 Ligands Regulate Monocyte Fcγ Receptor Expression and Function

Shah, Prexy; Fatehchand, Kavin; Patel, Hemal H.; Fang, Huiqing; Justiniano, Steven E.; Mo, Xiaokui; Jarjoura, David; Tridandapani, Susheela; Butchar, Jonathan P.

doi:10.1074/jbc.m113.449983

Cited by 20 publications

(23 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1A) showed that agonists for TLR4 and TLR8 almost completely eliminated Fc␥RIIb, whereas agonists for TLR9 showed modest effects. TLR2 agonists led to variable results, occasionally leading to a slight decrease but, more often, to a modest increase in Fc␥RIIb, which is in agreement with our earlier findings (47). We repeated this and examined the transcript levels of Fc␥RIIb and found similar results (Fig.…”

Section: Resultssupporting

confidence: 80%

“…Sequences for Fc␥RIIa, Fc␥RIIb, and GAPDH were as described previously (47). Primer sequences to detect MARCH transcripts were as follows: MARCH3 forward, GCGAGGACGATGGAAATCCT; MARCH3 reverse, CTTGCATGACATACTGCGGC; MARCH7 forward, CAAGCACACGTGTCCGATTTA; MARCH7 reverse, TGGTCTCCGTCTTCTTCGGA; MARCH9 forward, AGAA-GGTCCAGATTGCTGCC; and MARCH9 reverse, GATGA-GGCCTATGCAGACGA.…”

Section: Methodsmentioning

confidence: 99%

“…Phagocytosis-Phagocytosis assays were performed as described previously (47). Briefly, IgG-coated, PKH26-labeled sheep red blood cells (SRBC) were added to the PBM.…”

Section: Real-time Rt-pcr (Qpcr)-cellsmentioning

confidence: 99%

See 2 more Smart Citations

Toll-like Receptor 4 Ligands Down-regulate Fcγ Receptor IIb (FcγRIIb) via MARCH3 Protein-mediated Ubiquitination

Fatehchand

Elavazhagan

et al. 2016

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Monocytes and macrophages are critical for the effectiveness of monoclonal antibody therapy. Responses to antibody-coated tumor cells are largely mediated by Fc␥ receptors (Fc␥Rs), which become activated upon binding to immune complexes. Fc␥RIIb is an inhibitory Fc␥R that negatively regulates these responses, and it is expressed on monocytes and macrophages. Therefore, deletion or down-regulation of this receptor may substantially enhance therapeutic outcomes. Here we screened a panel of Toll-like receptor (TLR) agonists and found that those selective for TLR4 and TLR8 could significantly down-regulate the expression of Fc␥RIIb. Upon further examination, we found that treatment of monocytes with TLR4 agonists could lead to the ubiquitination of Fc␥RIIb protein. A search of our earlier microarray database of monocytes activated with the TLR7/8 agonist R-848 (in which Fc␥RIIb was down-regulated) revealed an up-regulation of membrane-associated ring finger (C3HC4) 3 (MARCH3), an E3 ubiquitin ligase. Therefore, we tested whether LPS treatment could up-regulate MARCH3 in monocytes and whether this E3 ligase was involved with LPS-mediated Fc␥RIIb down-regulation. The results showed that LPS activation of TLR4 significantly increased MARCH3 expression and that siRNA against MARCH3 prevented the decrease in Fc␥RIIb following LPS treatment. These data suggest that activation of TLR4 on monocytes can induce a rapid down-regulation of Fc␥RIIb protein and that this involves ubiquitination.Monocytes and macrophages play an important role in the innate immune response by phagocytosing IgG-opsonized infectious particles (1) and are major mediators in the destruction of tumor cells (2-5). Indeed, the importance of monocytes in clearing antibody-targeted tumor cells following the administration of therapeutic mAbs used in oncology indications has been well established (6 -8). However, despite showing statistically significant effects, the low rates of complete remission combined with the relatively high relapse rate suggest strongly that there is much room for improvement (9 -11). Therapeutic mAbs themselves are being improved, with the goal of increasing affinity toward Fc␥ receptors in some cases (12, 13). Along with this, immune modulators such as interferons (14, 15), interleukins (16 -20), synthetic compounds (21-23), and CpG oligonucleotides (16) are being explored as potential enhancers of antibody therapy.Antibody-dependent destruction of target cells is largely mediated by Fc␥ receptors (Fc␥Rs) 4 (5, 24, 25). Human monocytes and macrophages express at least four different functional Fc␥Rs: Fc␥RI, Fc␥RIIa, Fc␥RIIb, and Fc␥RIIIa (26). Of these, Fc␥RI, Fc␥RIIa, and Fc␥RIIIa are activating receptors that drive cellular responses to antibodies. These receptors either contain, within their cytoplasmic tails, an immune receptor tyrosine-based activation motif (ITAM), as in the case of Fc␥RIIa (27), or are associated with the ␥-chain homodimer that has an ITAM (28). The association of the ␥-chain is critical not only for surfa...

show abstract

Section: Resultssupporting

confidence: 80%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Toll-like Receptor 4 Ligands Down-regulate Fcγ Receptor IIb (FcγRIIb) via MARCH3 Protein-mediated Ubiquitination

Fatehchand

Elavazhagan

et al. 2016

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…Generally this result in the uptake of TLR2 bound molecules and cellular activation of APCs (30–32). TLR2 recognizes lipoteichoic acid (33–35), zymosan (36, 37), and bacterial lipoproteins (38–40).…”

Section: Tlr2 and Lipopeptidesmentioning

confidence: 99%

Immunostimulation by Synthetic Lipopeptide-Based Vaccine Candidates: Structure-Activity Relationships

Zaman¹,

Tóth²

2013

Front. Immunol.

View full text Add to dashboard Cite

Peptide-based vaccines offer several advantages over conventional whole organism or protein approaches by offering improved purity and specificity in inducing immune response. However, peptides alone are generally non-immunogenic. Concerns remain about the toxicity of adjuvants which are critical for immunogenicity of synthetic peptides. The use of lipopeptides in peptide vaccines is currently under intensive investigation because potent immune responses can be generated without the use of adjuvant (thus are self-adjuvanting). Several lipopeptides derived from microbial origin, and their synthetic versions or simpler fatty acid moieties impart this self-adjuvanting activity by signaling via Toll-like receptor 2 (TLR2). Engagement of this innate immune receptor on antigen-presenting cell leads to the initiation and development of potent immune responses. Therefore optimization of lipopeptides to enhance TLR2-mediated activation is a promising strategy for vaccine development. Considerable structure-activity relationships that determine TLR2 binding and consequent stimulation of innate immune responses have been investigated for a range of lipopeptides. In this mini review we address the development of lipopeptide vaccines, mechanism of TLR2 recognition, and immune activation. An overview is provided of the best studied lipopeptide vaccine systems.

show abstract

“…Activation of Fc␥R also elicits cytokine production by monocytes, which serves to activate other immune effectors, such as natural killer (NK) cells (2)(3)(4)(5)(6)(7)(8). This involves the activation of Src kinases and Syk and then branches to other mediators (9).…”

mentioning

confidence: 99%

Analysis of the Effects of the Bruton's tyrosine kinase (Btk) Inhibitor Ibrutinib on Monocyte Fcγ Receptor (FcγR) Function

Campbell²,

Fang³

et al. 2016

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

The irreversible Bruton's tyrosine kinase (Btk) inhibitor ibrutinib has shown efficacy against B-cell tumors such as chronic lymphocytic leukemia and B-cell non-Hodgkin lymphoma. Fc␥ receptors (Fc␥R) on immune cells such as macrophages play an important role in tumor-specific antibody-mediated immune responses, but many such responses involve Btk. Here we tested the effects of ibrutinib on Fc␥R-mediated activities in monocytes. We found that ibrutinib did not affect monocyte Fc␥R-mediated phagocytosis, even at concentrations higher than those achieved physiologically, but suppressed Fc␥R-mediated cytokine production. We confirmed these findings in macrophages from Xid mice in which Btk signaling is defective. Because calcium flux is a major event downstream of Btk, we tested whether it was involved in phagocytosis. The results showed that blocking intracellular calcium flux decreased Fc␥R-mediated cytokine production but not phagocytosis. To verify this, we measured activation of the GTPase Rac, which is responsible for actin polymerization. Results showed that ibrutinib did not inhibit Rac activation, nor did the calcium chelator 1,2-bis(2-aminophenoxy)ethane-N,N,N,N-tetraacetic acid tetrakis(acetoxymethyl ester). We next asked whether the effect of ibrutinib on monocyte Fc␥R-mediated cytokine production could be rescued by IFN␥ priming because NK cells produce IFN␥ in response to antibody therapy. Pretreatment of monocytes with IFN␥ abrogated the effects of ibrutinib on Fc␥R-mediated cytokine production, suggesting that IFN␥ priming could overcome this Btk inhibition. Furthermore, in monocyte-natural killer cell co-cultures, ibrutinib did not inhibit Fc␥R-mediated cytokine production despite doing so in single cultures. These results suggest that combining ibrutinib with monoclonal antibody therapy could enhance chronic lymphocytic leukemia cell killing without affecting macrophage effector function.

show abstract

Toll-like Receptor 2 Ligands Regulate Monocyte Fcγ Receptor Expression and Function

Cited by 20 publications

References 36 publications

Toll-like Receptor 4 Ligands Down-regulate Fcγ Receptor IIb (FcγRIIb) via MARCH3 Protein-mediated Ubiquitination

Toll-like Receptor 4 Ligands Down-regulate Fcγ Receptor IIb (FcγRIIb) via MARCH3 Protein-mediated Ubiquitination

Immunostimulation by Synthetic Lipopeptide-Based Vaccine Candidates: Structure-Activity Relationships

Analysis of the Effects of the Bruton's tyrosine kinase (Btk) Inhibitor Ibrutinib on Monocyte Fcγ Receptor (FcγR) Function

Contact Info

Product

Resources

About