Toward a DNA Taxonomy of Alpine Rhithrogena (Ephemeroptera: Heptageniidae) Using a Mixed Yule-Coalescent Analysis of Mitochondrial and Nuclear DNA

Abstract

Aquatic larvae of many Rhithrogena mayflies (Ephemeroptera) inhabit sensitive Alpine environments. A number of species are on the IUCN Red List and many recognized species have restricted distributions and are of conservation interest. Despite their ecological and conservation importance, ambiguous morphological differences among closely related species suggest that the current taxonomy may not accurately reflect the evolutionary diversity of the group. Here we examined the species status of nearly 50% of European Rhithrogena diversity using a widespread sampling scheme of Alpine species that included 22 type localities, general mixed Yule-coalescent (GMYC) model analysis of one standard mtDNA marker and one newly developed nDNA marker, and morphological identification where possible. Using sequences from 533 individuals from 144 sampling localities, we observed significant clustering of the mitochondrial (cox1) marker into 31 GMYC species. Twenty-one of these could be identified based on the presence of topotypes (expertly identified specimens from the species' type locality) or unambiguous morphology. These results strongly suggest the presence of both cryptic diversity and taxonomic oversplitting in Rhithrogena. Significant clustering was not detected with protein-coding nuclear PEPCK, although nine GMYC species were congruent with well supported terminal clusters of nDNA. Lack of greater congruence in the two data sets may be the result of incomplete sorting of ancestral polymorphism. Bayesian phylogenetic analyses of both gene regions recovered four of the six recognized Rhithrogena species groups in our samples as monophyletic. Future development of more nuclear markers would facilitate multi-locus analysis of unresolved, closely related species pairs. The DNA taxonomy developed here lays the groundwork for a future revision of the important but cryptic Rhithrogena genus in Europe.

Pseudamnicola Paulucci, 1878 (Caenogastropoda: Truncatelloidea) from the Aegean Islands: a long or short story?

“…According to the phylogenetic analysis and p-distance values for COI, the studied Pseudamnicola populations can be assigned to 16 clades, most of which are probably distinct species, according to the GMYC and ABGD analysis. The GMYC procedure has been applied in several previous studies Papadopoulou et al 2009a, b;Adolfsson et al 2010;Pagès et al 2010;Powell et al 2011;Vuataz et al 2011), including some on molluscs (Nekola et al 2009;Lorion et al 2010;Jörger et al 2012;Jörger and Schrödl 2013). Reliability of species delimitated by GMYC has also been discussed in the literature (e.g.…”

Labiobaetis from the Kingdom of Saudi Arabia (Insecta, Ephemeroptera, Baetidae)

“…The CO1 gene was sequenced using LCO1490 and HCO2198 primers (Folmer et al 1994). We followed the laboratory procedures, edition and alignment of sequences as described in Vuataz et al (2011). The final data matrix included 41 CO1 sequences of 658 bp representing all the Labiobaetis taxa from Palearctic and Afrotropical regions for which sequences are available (Table 1).…”

New species of Indocloeon Müller-Liebenau from South-East Asia (Ephemeroptera, Baetidae)

“…The DNA of part of the specimens was extracted using non-destructive methods allowing subsequent morphological analysis (see Vuataz et al 2011 for details). We amplified a 658 bp fragment of the mitochondrial gene cytochrome oxidase subunit 1 (COI) using the primers LCO 1490 (GGTCAACAAATCATAAAGATATTGG) and HCO 2198 (TAAACTTCAGGGTGACCAAAAAATCA) (Folmer et al 1994).…”