Trans-complementation of polyhedrin by a stably transformed Sf9 insect cell line allows occ− baculovirus occlusion and larval per os infectivity

López, María Gabriela; Alfonso, Victoria; Carrillo, Elisa; Taboga, Oscar

doi:10.1016/j.jbiotec.2009.10.015

Cited by 12 publications

(8 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For the construction of the intermediate vector pFBDPH, The polyhedrin gene was obtained from TOPO-POL vector [32] digested with EcoRI, and cloned into pFastBacDual digested with the same enzyme. The 716 bp eGFP coding sequence was amplified using oligonucleotides GFP-for 5′ G CTCGAG ATGGTGAGCAAGGGCGAG 3′ and GFP-rev 5′ GT CTCGAG TTATTGTACAGCTCGTCCATGC 3′, both indicated with underlined XhoI restriction enzyme sites.…”

Section: Methodsmentioning

confidence: 99%

“…For the construction of the pIB109 vector, ac109 was cloned into pCR®8/GW/TOPO® (Invitrogen) and subcloned into pIB-V5/His-DEST (Invitrogen) by recombination using the LR Clonase II enzyme mix (Invitrogen), according to manufacturer’s protocols. As for p XXL 109 plasmid, ac109 was cloned into pCR®2.1-TOPO® vector, excised with SpeI and XhoI enzymes and subcloned into p XXL CAT vector [32].…”

Section: Methodsmentioning

confidence: 99%

“…Transfer vector pFBpPOLp109-109Y was constructed replacing in pFasBacDual vector polyhedrin and p10 promoters by polyhedrin gene and an upstream regulatory region of 323 bp and a C-terminal fusion of ac109 with yfp gene downstream of ac109 promoter. polyhedrin gene and its promoter were PCR amplified with primers PH-up 5′ GCCGGCATAGTACGC 3′ and POLSTOP [32] and cloned into pGEM-Teasy intermediate vector giving rise to pGEMpPOL. ac109 promoter sequence and ac109 gene without the STOP codon were amplified by PCR and cloned in pCR®8/GW/TOPO® to obtain TOPO.p109-109C entry vector, which was recombined into pIB-WY destination vector [28].…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

AcMNPV Core Gene ac109 Is Required for Budded Virion Transport to the Nucleus and for Occlusion of Viral Progeny

et al. 2012

Self Cite

View full text Add to dashboard Cite

The Autographa californica multiple nucleopolyhedrovirus (AcMNPV) ac109 core gene has been previously characterized as an essential late gene. Our results showed that budded virions could be detected in supernatants of infected Sf-9 cells, even when ac109 knockout viruses displayed a single-cell infection phenotype. Moreover, confocal microscopy analysis revealed that budded virions can enter the cytoplasm but are unable to enter the cell nucleus. This defect could be repaired by complementing ac109 in trans. In addition, polyhedra of normal size could be detected in Sf-9 nuclei infected with ac109 knockout viruses. However, electron microscopy demonstrated that these occlusion bodies were empty. Altogether, these results indicate that ac109 is required for infectivity of both phenotypes of virus.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

AcMNPV Core Gene ac109 Is Required for Budded Virion Transport to the Nucleus and for Occlusion of Viral Progeny

et al. 2012

Self Cite

View full text Add to dashboard Cite

show abstract

“…Thanks to the availability of broad-spectrum antibiotics, this stringent selection system was expanded to simple eukaryotic model organisms, and although most antibiotic resistance genes are of bacterial origin, they were easily adapted to eukaryotes by using 3 0 and 5 0 untranslated regulatory sequences [44]. Indeed, antibiotic selection systems have been developed for yeast [45][46][47][48], mammalian and insect cells [49][50][51][52][53][54], plant cells [55][56][57], fungus [58][59][60][61], amoeba [62], and protozoans [63][64][65][66]. In 1985, Steller and Pirrotta [67] used the broad-spectrum antibiotic G-418 and its corresponding resistance gene to select transformed Drosophila larvae and thus demonstrated that it was also possible to expand antibiotic resistance to metazoans.…”

Section: Antibiotic Markersmentioning

confidence: 99%

Selectable genetic markers for nematode transgenesis

Giordano-Santini

Dupuy

2011

Cell. Mol. Life Sci.

View full text Add to dashboard Cite

The nematode Caenorhabditis elegans has been used to study genetics and development since the mid-1970s. Over the years, the arsenal of techniques employed in this field has grown steadily in parallel with the number of researchers using this model. Since the introduction of C. elegans transgenesis, nearly 20 years ago, this system has been extensively used in areas such as rescue experiments, gene expression studies, and protein localization. The completion of the C. elegans genome sequence paved the way for genome-wide studies requiring higher throughput and improved scalability than provided by traditional genetic markers. The development of antibiotic selection systems for nematode transgenesis addresses these requirements and opens the possibility to apply transgenesis to investigate biological functions in other nematode species for which no genetic markers had been developed to date.

show abstract

“…S. frugiperda larvae are highly susceptible to infection with BVs injected into the haemocoel but resistant to oral infection (Haas-Stapleton et al 2003. In contrast, R. nu presents both oral and intrahaemocoelical susceptibility (Ferrer et al 2007;Loustau et al 2008;López et al 2010). Gong et al (2006) achieved an important increase in the expression level of the cholera toxin subunit B-insulin fusion protein by adding the PPHS element to the protein coding sequence.…”

Section: Introductionmentioning

confidence: 99%

Rachiplusia nu larva as a biofactory to achieve high level expression of horseradish peroxidase

et al. 2011

View full text Add to dashboard Cite

A process based on orally-infected Rachiplusia nu larvae as biological factories for expression and one-step purification of horseradish peroxidase isozyme C (HRP-C) is described. The process allows obtaining high levels of pure HRP-C by membrane chromatography purification. The introduction of the partial polyhedrin homology sequence element in the target gene increased HRP-C expression level by 2.8-fold whereas it increased 1.8-fold when the larvae were reared at 27 °C instead of at 24 °C, summing up a 4.6-fold overall increase in the expression level. Additionally, HRP-C purification by membrane chromatography at a high flow rate greatly increase D the productivity without affecting the resolution. The V(max) and K(m) values of the recombinant HRP-C were similar to those of the HRP from Armoracia rusticana roots.

show abstract

Trans-complementation of polyhedrin by a stably transformed Sf9 insect cell line allows occ− baculovirus occlusion and larval per os infectivity

Cited by 12 publications

References 20 publications

AcMNPV Core Gene ac109 Is Required for Budded Virion Transport to the Nucleus and for Occlusion of Viral Progeny

AcMNPV Core Gene ac109 Is Required for Budded Virion Transport to the Nucleus and for Occlusion of Viral Progeny

Selectable genetic markers for nematode transgenesis

Rachiplusia nu larva as a biofactory to achieve high level expression of horseradish peroxidase

Contact Info

Product

Resources

About