Trans-splicing of the mod(mdg4) Complex Locus Is Conserved Between the Distantly Related Species Drosophila melanogaster and D. virilis

Gabler, Manuela; Volkmar, Michael; Weinlich, Susan; Herbst, Andreas; Dobberthien, Philine; Sklarss, Stefanie; Fanti, Laura; Pimpinelli, Sergio; Kress, Horst; Reuter, Günter; Dorn, Rainer

doi:10.1534/genetics.103.020842

Cited by 36 publications

(29 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Reverse transcription was performed using random primers and AMV reverse transcriptase (Roche). PCR was carried out using control primers for RP49 (Gabler et al, 2005): rp-49-F, TGTCCTTCCAGCTTCAAGATGACCATC and rp-49-R, CTTGGGCTTGCGCCATTTGTG. mcph1 primers were, exon 6: F, GCCATTAACCACAATAAGCCATCGG, and exon 8: R, CTCATAGGGCTCT -TCATTGATCC.…”

Section: Rt-pcrmentioning

confidence: 99%

Microcephalin coordinates mitosis in the syncytialDrosophilaembryo

Brunk

Vernay

Griffith

et al. 2007

Journal of Cell Science

View full text Add to dashboard Cite

Microcephalin (MCPH1) is mutated in primary microcephaly, an autosomal recessive human disorder of reduced brain size. It encodes a protein with three BRCT domains that has established roles in DNA damage signalling and the cell cycle, regulating chromosome condensation. Significant adaptive evolutionary changes in primate MCPH1 sequence suggest that changes in this gene could have contributed to the evolution of the human brain. To understand the developmental role of microcephalin we have studied its function in Drosophila. We report here that Drosophila MCPH1 is cyclically localised during the cell cycle, co-localising with DNA during interphase, but not with mitotic chromosomes. mcph1 mutant flies have a maternal effect lethal phenotype, due to mitotic arrest occurring in early syncytial cell cycles. Mitotic entry is slowed from the very first mitosis in such embryos, with prolonged prophase and metaphase stages; and frequent premature separation as well as detachment of centrosomes. As a consequence, centrosome and nuclear cycles become uncoordinated, resulting in arrested embryonic development. Phenotypic similarities with abnormal spindle (asp) and centrosomin (cnn) mutants (whose human orthologues are also mutated in primary microcephaly), suggest that further studies in the Drosophila embryo may establish a common developmental and cellular pathway underlying the human primary microcephaly phenotype.

show abstract

Section: Rt-pcrmentioning

confidence: 99%

Microcephalin coordinates mitosis in the syncytialDrosophilaembryo

Brunk

Vernay

Griffith

et al. 2007

Journal of Cell Science

View full text Add to dashboard Cite

show abstract

“…Compared with cis-splicing, trans-splicing has been observed much less often in higher eukaryotes (McManus et al 2010;Zhang et al 2010). The best-characterized transspliced gene in higher eukaryotes is mod(mdg4) in Drosophila, which contains common 59 exons from one chromosomal locus and 31 alternative 39 exons from multiple loci, that are located on both DNA strands (Dorn and Krauss 2003;Gabler et al 2005;McManus et al 2010). It has been reported that the trans-splicing of mod(mdg4) is conserved in silkworm, based on evidence from one public EST sequence (Krauss and Dorn 2004).…”

Section: Introductionmentioning

confidence: 99%

Alternative splicing and trans-splicing events revealed by analysis of the Bombyx mori transcriptome

Shao¹,

Zhao²,

Wang³

et al. 2012

RNA

View full text Add to dashboard Cite

Alternative splicing and trans-splicing events have not been systematically studied in the silkworm Bombyx mori. Here, the silkworm transcriptome was analyzed by RNA-seq. We identified 320 novel genes, modified 1140 gene models, and found thousands of alternative splicing and 58 trans-splicing events. Studies of three SR proteins show that both their alternative splicing patterns and mRNA products are conserved from insect to human, and one isoform of Srsf6 with a retained intron is expressed sex-specifically in silkworm gonads. Trans-splicing of mod(mdg4) in silkworm was experimentally confirmed. We identified integrations from a common 59-gene with 46 newly identified alternative 39-exons that are located on both DNA strands over a 500-kb region. Other trans-splicing events in B. mori were predicted by bioinformatic analysis, in which 12 events were confirmed by RT-PCR, six events were further validated by chimeric SNPs, and two events were confirmed by allele-specific RT-PCR in F 1 hybrids from distinct silkworm lines of JS and L10, indicating that trans-splicing is more widespread in insects than previously thought. Analysis of the B. mori transcriptome by RNA-seq provides valuable information of regulatory alternative splicing events. The conservation of splicing events across species and newly identified trans-splicing events suggest that B. mori is a good model for future studies.

show abstract

“…Trans-splicing is found less commonly in many higher eukaryotes, including in several chloroplast and mitochondria genes in plants (Koller et al 1987;Pereira de Souza et al 1991), in mod(mdg4) and lola in flies (Horiuchi et al 2003;Gabler et al 2005), and in numerous genes in mammals (Fujieda et al 1996;Hu et al 2013). Recently, deep sequencing has enhanced the identification of transsplicing events throughout the transcriptome (McManus et al 2010;Zhang et al 2010;Shao et al 2012).…”

mentioning

confidence: 99%

“…In mod(mdg4), alternative 3 ′ exons from multiple loci on both DNA strands are trans-spliced to a 5 ′ transcript containing four common exons (Fig. 1A) and result in at least 31 isoforms (Labrador et al 2001;Dorn and Krauss 2003;Gabler et al 2005;McManus et al 2010). Trans-splicing of mod(mdg4) is conserved in insects, including silkworms (Shao et al 2012), mosquitos (Krauss and Dorn 2004), and cotton bollworms (Cai et al 2012).…”

mentioning

confidence: 99%

A conserved intronic U1 snRNP-binding sequence promotestrans-splicing inDrosophila

et al. 2015

View full text Add to dashboard Cite

Unlike typical cis-splicing, trans-splicing joins exons from two separate transcripts to produce chimeric mRNA and has been detected in most eukaryotes. Trans-splicing in trypanosomes and nematodes has been characterized as a spliced leader RNA-facilitated reaction; in contrast, its mechanism in higher eukaryotes remains unclear. Here we investigate mod(mdg4), a classic trans-spliced gene in Drosophila, and report that two critical RNA sequences in the middle of the last 5 ′ intron, TSA and TSB, promote trans-splicing of mod(mdg4). In TSA, a 13-nucleotide (nt) core motif is conserved across Drosophila species and is essential and sufficient for trans-splicing, which binds U1 small nuclear RNP (snRNP) through strong base-pairing with U1 snRNA. In TSB, a conserved secondary structure acts as an enhancer. Deletions of TSA and TSB using the CRISPR/Cas9 system result in developmental defects in flies. Although it is not clear how the 5 ′ intron finds the 3 ′ introns, compensatory changes in U1 snRNA rescue trans-splicing of TSA mutants, demonstrating that U1 recruitment is critical to promote trans-splicing in vivo. Furthermore, TSA core-like motifs are found in many other trans-spliced Drosophila genes, including lola. These findings represent a novel mechanism of trans-splicing, in which RNA motifs in the 5 ′ intron are sufficient to bring separate transcripts into close proximity to promote trans-splicing.

show abstract

Trans-splicing of the mod(mdg4) Complex Locus Is Conserved Between the Distantly Related Species Drosophila melanogaster and D. virilis

Cited by 36 publications

References 41 publications

Microcephalin coordinates mitosis in the syncytialDrosophilaembryo

Microcephalin coordinates mitosis in the syncytialDrosophilaembryo

Alternative splicing and trans-splicing events revealed by analysis of the Bombyx mori transcriptome

A conserved intronic U1 snRNP-binding sequence promotestrans-splicing inDrosophila

Contact Info

Product

Resources

About