Transcription factor Creb3l1 maintains proteostasis in neuroendocrine cells

Osmoadaptive GLP-1R signalling in hypothalamic neurones inhibits antidiuretic hormone synthesis and release

“…Copeptin and GLP-1 assays were performed in duplicate on whole plasma according to manufactures instructions. Pituitary hormone measures were performed as described previously [ 26 ]. The signal was detected on an iMark microplate absorbance reader (Bio-Rad Laboratories).…”

“…The most efficient shRNA target sequence was GCACGCATGAAGTCATCTTTG with 88.1% KD. Glp1r and non-targeting short hairpin RNAs (shRNAs) were cloned into pGFP-A-shAAV (OriGene) as previously described [ 26 ]. Adeno-associated virus (AAV) particles (AAV1/2) were produced using a helper free packaging system (Cell Biolabs, VPK-402 and VPK-421) and prepared to titres of 1 × 10 12 (AAV1/2-shRNA constructs) genome copies per ml in phosphate buffered saline (PBS) for injection as described previously [ 24 ].…”

“…Stereotaxic injections were performed as described previously [ 26 ]. The success of viral injections was verified at the end of each study by visualisation of the fluorescent reporter in cryostat cut sections or qRT-PCR [ 26 ].…”

“…We have found that transcription factor CREB3L1 is crucial for regulating hypothalamic AVP and OXT synthesis and secretion [ [20] , [21] , [22] , [23] , [24] , [25] ]. We recently showed that CREB3L1 plays a more fundamental cellular role as a regulator of MCN protein synthesis and secretion in order to meet dynamically changing physiological demands [ 26 ]. In this study, we have mined our SON Creb3l1 knockdown (KD) transcriptomic dataset and identified dramatically decreased expression of several GPCRs included the glucagon like peptide 1 receptor (GLP-1R).…”

Hypothalamic extraretinal photoreceptor Opsin3 regulates water balance, body temperature and motor activity

“…Briefly, 1 μl containing 1.59 × 10 9 AAV-shOpn3-eGFP viral particles or 1 μl containing 1.31 × 10 9 AAV-shNT-eGFP particles were injected into the SON by stereotaxic delivery at coordinates 1.3 mm caudal, ±1.95 mm lateral, and −8.8 mm ventral to bregma. For RNA-seq analysis and immunofluorescence, rats were injected with AAV-shOpn3-eGFP in one SON and with AAV-shNT-eGFP in the other SON as in (Greenwood et al, 2022). For physiological studies, rats were injected bilaterally in the SON with AAV-shOpn3-eGFP or AAV-shNT-eGFP.…”