Transcription of the gene coding for subunit 9 of ATP synthase in rice mitochondria

Kaleikau, Edward K.; André, Charles P.; Walbot, Virginia

doi:10.1007/bf00027375

Cited by 7 publications

(4 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Similar structures can be found close to the 3' termini of various mitochondrial RNAs from higher plants [32,38], Chlamydomonas [9,10], and P. wickerhamii (data not shown). Due to the lack of an efficient transformation system, no functional studies of these structures in mitochondria are yet available regarding their properties in vivo.…”

Section: Polycistronic Transcripts Undergo Substantial Processing Eventssupporting

confidence: 51%

Transcript mapping and processing of mitochondrial RNA in the chlorophyte alga Prototheca wickerhamii

Wolff

Kück

1996

Plant Mol Biol

View full text Add to dashboard Cite

The detailed transcript map of the circular 55328 bp mitochondrial (mt) genome from the colourless chlorophycean alga Prototheca wickerhamii has been determined. On each half of this genome the genes are encoded only on one DNA strand, forming transcriptional units comprising variable numbers of genes. With the exception of four genes coding for ribosomal proteins, transcripts of the three rRNA genes and all protein-coding genes have been detected by both northern analysis and primer extension experiments. Polycistronic transcripts of protein coding and tRNA genes were verified by northern analyses, primer extension and RNAse mapping experiments. The 5' and 3' ends of different RNA species are often located in close proximity to putative stem-loop structures and some 5' termini of mRNAs coincide with the 3' end of tRNAs located immediately upstream. Transcript mapping in a putative promoter region revealed two different possible transcription initiation sites; no significant sequence homology to putative mt promoters from higher plants could be found. In addition, two out of three group I introns residing in the cox1 gene were found to be self-splicing in vitro under reaction conditions developed for related mt introns from a filamentous fungus. Mitochondrial gene expression of P. wickerhamii and of filamentous fungi has several features in common, such as intron splicing and the processing of longer polycistronic transcripts. The similarities in RNA maturation between higher-plant and P. wickerhamii mitochondria are less pronounced, since plants rarely use tRNAs as processing signals for their relatively short mitochondrial co-transcripts.

show abstract

Section: Polycistronic Transcripts Undergo Substantial Processing Eventssupporting

confidence: 51%

Transcript mapping and processing of mitochondrial RNA in the chlorophyte alga Prototheca wickerhamii

Wolff

Kück

1996

Plant Mol Biol

View full text Add to dashboard Cite

show abstract

“…The 3' terminus of the block is the 5' recombination breakpoint involved in positioning atp6 promoters 5' to Turf13 (Dewey et aL, 1986;Kennell and Pring, 1989), and recombination through the 3' terminal 6 bp of this block with identical sequences internal to sorghum urf209 (orf25) in part generated sorghum orf265 (Tang et aL, 1996). No function has been assigned to this sequence, although maize rrn26 and rice atp9 transcript processing sites occur 28 and 29 bp, respectively, 3' to the block (Kaleikau et aL, 1993;Maloney et aL, 1989), suggesting that the block sequences may represent common processing sites (Kaleikau et aL, 1993). However, no transcript processing sites for sorghum orf107, atp9 (Yan et aL, in preparation), and orf265/130 (Tang et al, 1996), or maize atp6 (Kennell and Pring, 1989), are associated with the block.…”

Section: Sequencing Of Off107mentioning

confidence: 99%

Transcript processing internal to a mitochondrial open reading frame is correlated with fertility restoration in male‐sterile sorghum

Tang¹,

et al. 1996

View full text Add to dashboard Cite

SummaryA chimeric mitochondrial DNA (mtDNA) configuration of the cytoplasmic male-sterile (cms) sorghum line ISl112C includes a 321 bp open reading frame designated orfl07, encoding a predicted polypeptide product of 11.85 kDa. The open reading frame, similar to several other genes associated with cms, consists of amino-terminal sequences derived from an obligate gene. Unlike other examples to date, however, the carboxy-terminal sequences are highly similar to the carboxy terminus of an open reading frame implicated in cms of rice, orf79. The amino-terminal 31 residues of orfl07 are 84% similar to atp9, and the carboxy-terminal 49 residues are 57% identical and 80% similar to the carboxy terminus of orf79. Transcripts of off107 are edited, with four C-to-U changes that alter amino acids. Sorghum lines partially or fully restored to fertility exhibit a high-efficiency internal-orfl07 transcript processing activity, precluding abundant wholelength transcripts, while male-sterile lines exhibit only a trace of the activity. Previous data on the abundance of a 12 kDa in organello-synthesized polypeptide in male-sterile versus male-fertile lines are correlated with differential o#107 transcript processing activity of these lines. Examinations of backcross and F 2 lines suggest a gametophytic mode of restoration, and indicate that enhanced transcript processing activity is necessary, but not sufficient, to restore full fertility. These novel observations indicate that mitochondrial open reading frames associated with cms

show abstract

“…1, se-quence A). These regions are proposed to be a 5'-processing site for plant mitochondrial transcripts [9,23,27]. 51 bp upstream from the conserved atp9-1 reading frame a 9 bp sequence block, GGAAT-CAAT was identified which shows high homology to the 3' terminus of the rrn18 gene from Oenothera (eight out of nine nucleotides are identical) (nucleotides 88 to 97; Fig.…”

Section: Ggagctgctacaattgct Tc=~agcgggagctgctgtcggtattggaaacgtct Tcagmentioning

confidence: 99%

The Tokumasu radish mitochondrial genome contains two complete atp9 reading frames

et al. 1995

View full text Add to dashboard Cite

Two copies of the gene atp9, encoding subunit 9 of the mitochondrial F1F0-ATPase, have been cloned from the Tokumasu radish (Raphanus sativus L.) cytoplasm. The genomic DNA and the corresponding cDNA sequences of the coding regions were determined. Both alleles contain a 222 bp long and well conserved atp9 reading frame, coding for a 74 amino acid polypeptide. The Tokumasu atp9-1 gene may have a unique N-terminal extension of 11 amino acid residue relative to other plant atp9 genes. In comparison of cDNA and genomic sequences four RNA editing events were found in both atp9 genes. Northern experiments indicate different transcription patterns for the two genes.

show abstract

Transcription of the gene coding for subunit 9 of ATP synthase in rice mitochondria

Cited by 7 publications

References 22 publications

Transcript mapping and processing of mitochondrial RNA in the chlorophyte alga Prototheca wickerhamii

Transcript mapping and processing of mitochondrial RNA in the chlorophyte alga Prototheca wickerhamii

Transcript processing internal to a mitochondrial open reading frame is correlated with fertility restoration in male‐sterile sorghum

The Tokumasu radish mitochondrial genome contains two complete atp9 reading frames

Contact Info

Product

Resources

About