Transcriptional analysis of the ylaABCD operon of Bacillus subtilis encoding a sigma factor of extracytoplasmic function family

Matsumoto, Takashi; Nakanishi, Kaoru; Asai, Kei; Sadaie, Yoshito

doi:10.1266/ggs.80.385

Cited by 16 publications

(19 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In contrast, Y was shown to directly activate transcription from only two target promoters: the one that controls the sigY operon (sigY-yxlCDEFG) and one for ybgB (16). The functions of YlaC (37) and Z are presently unclear, and their cognate regulons are not well defined.…”

Section: Bacillus Subtilis Harbors Seven Extracytoplasmic Function (Ementioning

confidence: 99%

Transcriptomic and Phenotypic Characterization of aBacillus subtilisStrain without Extracytoplasmic Function σ Factors

et al. 2010

Self Cite

View full text Add to dashboard Cite

Bacillus subtilis encodes seven extracytoplasmic function (ECF) factors. Three ( M , W , and X ) mediate responses to cell envelope-active antibiotics. The functions of V , Y , Z , and YlaC remain largely unknown, and strong inducers of these factors and their regulons have yet to be defined. Here, we define transcriptomic and phenotypic differences under nonstress conditions between a strain carrying deletions in all seven ECF factor genes (the ⌬7ECF mutant), a ⌬MWX triple mutant, and the parental 168 strain. Our results identify >80 genes as at least partially dependent on ECF factors, and as expected, most of these are dependent on M , W , or X , which are active at a significant basal level during growth. Several genes, including the eps operon encoding enzymes for exopolysaccharide (EPS) production, were decreased in expression in the ⌬7ECF mutant but affected less in the ⌬MWX mutant. Consistent with this observation, the ⌬7ECF mutant (but not the ⌬MWX mutant) showed reduced biofilm formation. Extending previous observations, we also note that the ⌬MWX mutant is sensitive to a variety of antibiotics and the ⌬7ECF mutant is either as sensitive as, or slightly more sensitive than, the ⌬MWX strain to these stressors. These findings emphasize the overlapping nature of the seven ECF factor regulons in B. subtilis, confirm that three of these ( M , W , and X ) play the dominant role in conferring intrinsic resistance to antibiotics, and provide initial insights into the roles of the remaining ECF factors.

show abstract

Section: Bacillus Subtilis Harbors Seven Extracytoplasmic Function (Ementioning

confidence: 99%

Transcriptomic and Phenotypic Characterization of aBacillus subtilisStrain without Extracytoplasmic Function σ Factors

et al. 2010

Self Cite

View full text Add to dashboard Cite

show abstract

“…subtilis has seven ECF sigma genes (sigM, sigV, sigW, sigX, sigY, sigZ, and ylaC), which are negatively regulated by antisigma proteins, except for sigZ (2,6,7,9,13,16,25,26,27). Inactivation of these sigma genes one at a time does not affect viability because the sigma factors seem to overlap functionally (6,9,10,16,26). A quadruple mutant (⌬sigV ⌬sigY ⌬sigZ ⌬ylaC) of B. subtilis was constructed and was found to be viable (15).…”

mentioning

confidence: 99%

A ViableBacillus subtilisStrain without Functional Extracytoplasmic Function Sigma Genes

et al. 2008

Self Cite

View full text Add to dashboard Cite

We constructed a Bacillus subtilis Marburg strain that harbors deletion mutations in all seven extracytoplasmic function (ECF) sigma genes. The strain shows wild-type growth at 37°C both in a complex and in a synthetic medium and exhibits wild-type sporulation. ECF sigma genes of B. subtilis are dispensable as long as no stress is imposed, although they seem to be required for quick response to stresses.Since the assignment of sigma E of Streptomyces coelicolor to a subfamily of eubacterial RNA polymerase sigma factors (14), many sigma factors belonging to this family have been described (3, 4, 9, 18, 22). These sigma factors were called extracytoplasmic function (ECF) sigma factors, as they were found to direct the expression of proteins functioning in the outer membrane or in periplasmic space (14). Further analysis, however, revealed that these sigma factors direct expression of proteins functioning in cytoplasmic space, as well (2,5,9,21,28).The numbers of ECF sigma genes vary among bacterial species. Some bacteria have lost ECF sigma genes, and some bacteria possess a lot of them (9). These ECF sigma genes are believed to be nonessential and auxiliary in nature, although inactivation of rpoE in Escherichia coli and sigG in Synechocystis sp. strain PCC6803 was proven to be lethal (8, 11). In Bacillus subtilis W23, simultaneous inactivation of sigX and sigM causes a growth defect (17). However, the exact roles of those sigma genes in the maintenance of growth have still not been elucidated, and there is no study in which all stress sigma genes have been systematically inactivated in an organism. For this study, we successively interrupted all ECF sigma genes of B. subtilis to construct an ECF sigmaless strain in order to examine whether the genes are indispensable or merely auxiliary.B. subtilis has seven ECF sigma genes (sigM, sigV, sigW, sigX, sigY, sigZ, and ylaC), which are negatively regulated by antisigma proteins, except for sigZ (2,6,7,9,13,16,25,26,27). Inactivation of these sigma genes one at a time does not affect viability because the sigma factors seem to overlap functionally (6,9,10,16,26). A quadruple mutant (⌬sigV ⌬sigY ⌬sigZ ⌬ylaC) of B. subtilis was constructed and was found to be viable (15).In order to examine whether there is a minimal set of ECF sigma genes required for B. subtilis growth under nonstress conditions, we constructed deletion mutations in all seven ECF sigma genes on the genome of B. subtilis Marburg 168 (trpC2) as outlined in Fig. 1. Only one construction pathway is shown. There are many other possible pathways and many combinations of multiple disruptions, and we constructed a large number of different multiple disruptants (data not shown). During successive disruptions of ECF sigma genes, sufficient quantities of wild-type size transformants or segregants were obtained to suggest that there were no suppressor mutations, concerning colony size on LB agar, associated with the disruption of the ECF sigma genes. The sigW gene was disrupted at the end of the procedure becaus...

show abstract

“…Membrane filters were baked at 120°C for 30 min. The detection of DIG-labeled DNA fragments on the membranes was carried out as previously described (Matsumoto et al, 2005).…”

Section: Methodsmentioning

confidence: 99%

“…The primer extension experiment was carried out as described elsewhere (Matsumoto et al, 2005) with 3' DIG labeled primer 5' gtacggattgagccatgaatt 3', reverse transcriptase (Invitrogen Super Script TM II RNase H -Reverse Transcriptase, CA, USA) and RNA to determine the transcription start sites.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Functional analysis of the plastid and nuclear encoded CbbX proteins of Cyanidioschyzon merolae

et al. 2008

Self Cite

View full text Add to dashboard Cite

CbbX is believed to be a transcriptional regulator of the subunit genes (rbcL and rbcS) of RuBisCO (Ribulose 1,5-bisphosphate carboxylase/oxygenase) as well as possibly a molecular chaperon of RuBisCO subunit assembly. The unicellular red alga Cyanidioschyzon merolae strain 10D possesses two distinct cbbX genes; one is part of the plastid genome and the other is found in the cell nucleus, whereas the RuBisCO operon (rbcL-rbcS-cbbX) is located only on the plastid genome. We examined the role of CbbX proteins of C. merolae in the expression of the RuBisCO operon. First, His-tagged nuclear and plastid CbbX proteins were produced in Escherichia coli and purified by affinity column chromatography. Both proteins showed binding activity to upstream of the coding region of rbcL. Yeast two hybrid analysis showed direct interaction between nuclear and plastid CbbX proteins but no interaction were found among CbbX, RbcL and RbcS. Then the transcription initiation site of the RuBisCO operon of C. merolae was determined. Next, in order to examine the role of CbbX in vivo, we constructed a plasmid carrying the promoter region of the RuBisCO operon fused to Escherichia coli lacZ, and introduced it into E. coli cells into which a cloned nuclear or plastid cbbX gene under IPTG inducible promoter control was also introduced. Expression of LacZ in the transformed E.coli was observed. Enforced expression of either one of the cbbX genes resulted in a remarkable reduction of lacZ expression suggesting that CbbXs are rather transcriptional regulators than the molecular chaperon of RuBisCO. We discuss the mechanism by which the nuclear and plastid CbbX proteins regulate the RuBisCO operon of C. merolae.

show abstract

Transcriptional analysis of the ylaABCD operon of Bacillus subtilis encoding a sigma factor of extracytoplasmic function family

Cited by 16 publications

References 38 publications

Transcriptomic and Phenotypic Characterization of aBacillus subtilisStrain without Extracytoplasmic Function σ Factors

Transcriptomic and Phenotypic Characterization of aBacillus subtilisStrain without Extracytoplasmic Function σ Factors

A ViableBacillus subtilisStrain without Functional Extracytoplasmic Function Sigma Genes

Functional analysis of the plastid and nuclear encoded CbbX proteins of Cyanidioschyzon merolae

Contact Info

Product

Resources

About