Transcriptional organization of the F1845 fimbrial adhesin determinant of <i>Escherichia coli</i>

Bilge, Sima S.; Apostol, John M.; Fullner, Karia Jean; Moseley, Steve L.

doi:10.1111/j.1365-2958.1993.tb01191.x

Cited by 79 publications

(65 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The product of this gene is essential for assembly of functional adhesins of the Dr family (23,26). An insertional mutation of this nature could have polar effects on unknown genes downstream of the dra operon, although we considered this unlikely because transcriptional studies of the closely related daa operon indicate that transcription does not proceed beyond the operon (27). However, to assess the potential for polar effects of the transposon insertion of DR14, we examined by Northern blot analysis the expression of draE , the structural subunit of the Dr hemagglutinin.…”

Section: Resultsmentioning

confidence: 99%

Development of experimental model of chronic pyelonephritis with Escherichia coli O75:K5:H-bearing Dr fimbriae: mutation in the dra region prevented tubulointerstitial nephritis.

et al. 1997

View full text Add to dashboard Cite

show abstract

Section: Resultsmentioning

confidence: 99%

Development of experimental model of chronic pyelonephritis with Escherichia coli O75:K5:H-bearing Dr fimbriae: mutation in the dra region prevented tubulointerstitial nephritis.

et al. 1997

View full text Add to dashboard Cite

show abstract

“…One E. coli strain per stool was also evaluated by oligonucleotide probe hybridization for the heat-labile (LT) and heat-stable (STa) toxins (Fang et al, 1995). Fragment probes were used to evaluate for EPEC (eae, E. coli attaching and effacing gene; Jerse et al, 1991), and EAF (EPEC adherence factor; Nataro et al, 1985), DAEC (diffusely adherent E. coli; Bilge et al, 1993), EIEC (enteroinvasive E. coli; Wood et al, 1986), EHEC (enterohaemorrhagic E. coli; Levine et al, 1987) and EAEC (enteroaggregative E. coli; Baudry et al, 1990).…”

Section: Stool Processingmentioning

confidence: 99%

Giardia duodenalis assemblage, clinical presentation and markers of intestinal inflammation in Brazilian children

Kohli

Bushen

Pinkerton

et al. 2008

Transactions of the Royal Society of Tropical Medicine and Hygi

136

View full text Add to dashboard Cite

SummaryData on the relationship between the two genotypes of Giardia duodenalis that infect humans, assemblages A and B, their clinical presentation and intestinal inflammation are limited. We analyzed 108 stool samples previously collected for a diarrhoeal study among Brazilian children, representing 71 infections in 47 children. Assemblage B was most prevalent, accounting for 43/58 (74.1%) infections, while assemblage A accounted for 9/58 (15.5%) infections and 6/58 (10.3%) infections were mixed (contained both assemblage A and B). There was no significant difference in diarrhoeal symptoms experienced during assemblage A, B or mixed infections. Children with assemblage B demonstrated greater variability in G. duodenalis cyst shedding but at an overall greater level (n = 43, mean 3.6 × 10 5 , range 5.3 × 10 2 -2.5 × 10 6 cysts/ml) than children infected with assemblage A (n = 9, mean 1.4 × 10 5 , range 1.5 × 10 4 -4.6 × 10 5 cysts/ml; P = 0.009). Children with mixed infections shed more cysts (mean 8.3 × 10 5 , range 3.1 × 10 4 -2.8 × 10 6 cysts/ml) than children with assemblage A or B alone (P = 0.069 and P = 0.046 respectively). This higher rate of cyst shedding in children with assemblage B may propagate its spread, accounting for its increased incidence. Additionally, second and third infections had decreasing faecal lactoferrin, suggesting some protection against severity, albeit not against infection, by prior infection. Authors' contributions: AAML, RLG, AK and OYB designed the study protocol; RDN, AK and OYB carried out the clinical assessment; AK carried out and EH designed and carried out the quantitative PCR of Giardia; AK, RCP, OYB, CLS and RDN carried out the analysis and interpretation of these data; AK, OYB, RDN and CLS drafted the manuscript. All authors read and approved the final manuscript. AK and RLG are guarantors of the paper.Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Conflicts of interest: None declared.Ethical approval: The study protocol and informed consent were approved by the human investigations committees of the Federal

show abstract

“…Primer extensions were performed using primer iha.PE2 (5′CGAGACAGGGAATGACTACGGAAGC3′) as described [38].…”

Section: Primer Extension Analysismentioning

confidence: 99%

Expression of the Escherichia coli IrgA homolog adhesin is regulated by the ferric uptake regulation protein

Rashid

Tarr

Moseley

2006

Microbial Pathogenesis

Self Cite

View full text Add to dashboard Cite

The IrgA homologue adhesin (Iha) is an adherence-conferring outer membrane protein of Escherichia coli associated with enterohemorrhagic and uropathogenic strains. Here, we used primer extension analysis to identify iha promoters in O157:H7 and uropathogenic E. coli strains. Transcriptional fusions demonstrated that iha transcription is repressed by iron. Gel shifts using purified ferric uptake regulator protein (Fur) demonstrated that repression involves a direct interaction between Fur and the iha promoter. We identified strain-dependent differences in iha expression and determined that single nucleotide polymorphisms upstream of the iha promoter, in particular position −85, contribute to differences in expression levels.

show abstract

Transcriptional organization of the F1845 fimbrial adhesin determinant of Escherichia coli

Cited by 79 publications

References 53 publications

Development of experimental model of chronic pyelonephritis with Escherichia coli O75:K5:H-bearing Dr fimbriae: mutation in the dra region prevented tubulointerstitial nephritis.

Development of experimental model of chronic pyelonephritis with Escherichia coli O75:K5:H-bearing Dr fimbriae: mutation in the dra region prevented tubulointerstitial nephritis.

Giardia duodenalis assemblage, clinical presentation and markers of intestinal inflammation in Brazilian children

Expression of the Escherichia coli IrgA homolog adhesin is regulated by the ferric uptake regulation protein

Contact Info

Product

Resources

About