Transcriptome Analysis in Prenatal IGF1-Deficient Mice Identifies Molecular Pathways and Target Genes Involved in Distal Lung Differentiation

Abstract

BackgroundInsulin-like Growth Factor 1 (IGF1) is a multifunctional regulator of somatic growth and development throughout evolution. IGF1 signaling through IGF type 1 receptor (IGF1R) controls cell proliferation, survival and differentiation in multiple cell types. IGF1 deficiency in mice disrupts lung morphogenesis, causing altered prenatal pulmonary alveologenesis. Nevertheless, little is known about the cellular and molecular basis of IGF1 activity during lung development.Methods/Principal FindingsPrenatal Igf1−/− mutant mice with a C57Bl/6J genetic background displayed severe disproportional lung hypoplasia, leading to lethal neonatal respiratory distress. Immuno-histological analysis of their lungs showed a thickened mesenchyme, alterations in extracellular matrix deposition, thinner smooth muscles and dilated blood vessels, which indicated immature and delayed distal pulmonary organogenesis. Transcriptomic analysis of Igf1−/− E18.5 lungs using RNA microarrays identified deregulated genes related to vascularization, morphogenesis and cellular growth, and to MAP-kinase, Wnt and cell-adhesion pathways. Up-regulation of immunity-related genes was verified by an increase in inflammatory markers. Increased expression of Nfib and reduced expression of Klf2, Egr1 and Ctgf regulatory proteins as well as activation of ERK2 MAP-kinase were corroborated by Western blot. Among IGF-system genes only IGFBP2 revealed a reduction in mRNA expression in mutant lungs. Immuno-staining patterns for IGF1R and IGF2, similar in both genotypes, correlated to alterations found in specific cell compartments of Igf1−/− lungs. IGF1 addition to Igf1−/− embryonic lungs cultured ex vivo increased airway septa remodeling and distal epithelium maturation, processes accompanied by up-regulation of Nfib and Klf2 transcription factors and Cyr61 matricellular protein.Conclusions/SignificanceWe demonstrated the functional tissue specific implication of IGF1 on fetal lung development in mice. Results revealed novel target genes and gene networks mediators of IGF1 action on pulmonary cellular proliferation, differentiation, adhesion and immunity, and on vascular and distal epithelium maturation during prenatal lung development.

Differential organ phenotypes after postnatal Igf1r gene conditional deletion induced by tamoxifen in UBC-CreERT2; Igf1r fl/fl double transgenic mice

“…muscle, skeleton, skin, and adipose tissue), and whose growth is heavily dependent on IGFs, were not measured in the mutants, but their growth deficit would possibly explain whole mice delayed growth. Surprisingly, we did not find changes in lung weight of UBC-CreERT2; Igf1r fl/fl conditional mutants, even though both prenatal and postnatal growth of this organ was extensively described to be highly dependent on IGF signaling (Epaud et al 2012;Liu et al 1993;Moreno-Barriuso et al 2006;Pais et al 2013;Wang et al 1999). This discrepancy could be attributed either to differences in the mouse model or timing of tissue analyses in each study.…”

“…Histological changes were also found in liver and alveolar lung parenchyma, perceived as abundant mitotic figures in the liver and increased cell density in alveolar areas, most probably a consequence of their increased proliferation rates. In addition, morphological changes in lung epithelial cells of the terminal bronchioles could be a result of alterations in differentiation of Clara cells, which are highly abundant in terminal airways and express prominent levels of IGF1R (Morrisey and Hogan 2010;Pais et al 2013) (our unpublished data). Accordingly, lack of IGF1 and IGF1R was reported to promote cell proliferation and to alter epithelial differentiation not only in the lung (Epaud et al 2012;Liu et al 1993;Moreno-Barriuso et al 2006;Pais et al 2013), but also in the prostate (Sutherland et al 2008).…”

“…Mice were genotyped by standard PCR analysis of tail DNA obtained as described (Pais et al 2013), and using specific primers for each gene designed as shown in Fig. 1b, c. Presence of UBC-CreERT2 transgene was detected using primers F (5 0 -TGAA GCTCCGGTTTTGAACT-3 0 ) and R (5 0 -TGGTGT ACGGTCAGTAAATTGG-3 0 ), in combination with two additional primers for the IL2 gene, IL2F (5 0 -CT AGGCCACAGAATTGAAAGATCT) and IL2R (5 0 -GTAGGTGGAAATTCTAGCATCATCC-3 0 ), used as an internal PCR positive control.…”

Smooth Muscle Insulin-Like Growth Factor-1 Mediates Hypoxia-Induced Pulmonary Hypertension in Neonatal Mice

“…In addition, we show that chronic hypoxia further elevates IGF-1 levels in the neonatal period. Absence of IGF-1 results in prenatal lung hypoplasia and abnormal vascularization in mice (17,18). In direct contrast with total gene knockout, SMC-specific deletion of IGF-1 did not affect viability or body weights of neonatal mice at 2 weeks of age (8).…”

“…Reverse transcription was performed using Superscript III (Invitrogen) and oligo (dT) [12][13][14][15][16][17][18] primers, and real-time quantitative PCR was set up containing Power SYBR Green Master Mix (Applied Biosystems, Foster City, CA). The sequences for IGF-1 exon 4-specific primers used are shown in Table 1, and b-actin was used as an endogenous control.…”