Transfers to Simsia and description of Davilanthus, a new genus of Asteraceae (Heliantheae)

Abstract

Taxonomic changes are made to reflect a reassessment of morphology based on the results of molecular phylogenetic studies. A new genus, Davilanthus, is described to include six species that collectively form the sister group to Simsia, and includes the following species transferred from Viguiera: Davilanthus davilae, Davilanthus hidalgoanus, Davilanthus hypargyreus, Davilanthus huajuapanus, Davilanthus purpusii, and Davilanthus sericeus. Three species formerly placed in Viguiera ser. Grammatoglossae are transferred to Simsia: Simsia benziorum, Simsia ovata, and Simsia rhombifolia.

A revised classification of subtribe Helianthinae (Asteraceae: Heliantheae) II. Derived lineages

“…The sister group relationship of Davilanthus and Simsia was the focus of Schilling & Panero (2010), and no further nomenclatural adjustments are needed.…”

“…Schilling & Panero (1996b, 2010) presented comprehensive data on the relationships of Tithonia and Lagascea to one another, and to Simsia and Davilanthus . Lagascea is a small genus characterized by reduction and condensation of its heads into tertiary units (Stuessy, 1978; Harris, 1994), and a close relationship to Tithonia is not suggested by morphology.…”

“…and Simsia Pers. (Schilling & Panero, 2010). Partial ETS sequences were also obtained for 63 accessions representing 62 ingroup taxa and one outgroup (; many of the species are renamed here; see the Taxonomic Treatment section below for the authors).…”

“…Partial ETS sequences were also obtained for 63 accessions representing 62 ingroup taxa and one outgroup (; many of the species are renamed here; see the Taxonomic Treatment section below for the authors). DNA extraction, polymerase chain reaction (PCR) and sequencing protocols followed Schilling & Panero (2010). The primers used for ITS were ITS‐4 (5′‐TCCTCCGCTTATTGATATGC‐3′) and ITS‐5 (5′‐GGAAGTAAAAGTCGTAACAAGG‐3′; White et al ., 1990).…”

“…The current study was undertaken to complete the survey of variation in internal transcribed spacer (ITS) sequences in Helianthinae (Schilling & Panero, 2002, 2010), and to combine the resulting data with information from a partial data matrix of external transcribed spacer (ETS) sequences, plastid DNA results and morphology to provide a comprehensive estimate of relationships of the derived lineages of the subtribe. Sampling was extended to include all genera of Helianthinae and all of the major infrageneric units (at the level of series and above) of Viguiera as delimited by Blake (1918).…”