Transformation of Leuconostoc carnosum 4010 and Evidence for Natural Competence of the Organism

Abstract

Plasmid transformation in Leuconostoc carnosum 4010 was analyzed. A successful transformation protocol for L. carnosum was established by modifying an existing protocol for Lactococcus lactis. Several parameters, including the number of generations that the cells had grown at the time of harvest, glycine concentration, the time of incubation for phenotypic expression, and the electrical field strength, were investigated and proved to have influence on the transformation frequency. Electrocompetence was found to be transient and to peak in the early exponential growth phase. Optimized conditions resulted in transformation frequencies of up to 6.7 ؋ 10 5 transformants per microgram of plasmid DNA. A total of five plasmids in L. carnosum were successfully introduced and maintained. Interestingly, we discovered that DNA uptake was of a frequency of 3 ؋ 10 ؊6 to 19 ؋ 10 ؊6 transformants per CFU in the absence of an applied electrical field. We concluded that L. carnosum is naturally competent.Lactic acid bacteria (LAB) have the potential to preserve foods and have been used for this purpose for thousands of years. One important attribute of LAB is their ability to produce several metabolic products like organic acids, fatty acids, hydrogen peroxide, and diacetyl that have antimicrobial effects (4,13,15). In recent years interest has been paid to the ability of LAB to produce antimicrobial compounds called bacteriocins. These compounds have potential as natural substitutes for chemical food preservatives in the production of foods with an enhanced shelf life (3,18).Leuconostoc species are widespread in the natural environment and are of technological interest in many different food industries due to their advantageous fermentation characteristics (6). Leuconostoc carnosum is a facultative anaerobic, psychrotrophic LAB, originally associated with spoiled, packaged-meat products (1,8,16). However, investigations have revealed that this spoilage organism is a powerful inhibitor of bacterial growth due to its production of bacteriocins, with particularly strong antagonistic activity against the food-borne pathogen Listeria monocytogenes (2).Advances in genetic technologies have made it possible to develop LAB starter cultures with enhanced fermentation characteristics, and today the genetic manipulation of LAB through the introduction of plasmid DNA has many potential applications in the development of improved food products. Electroporation has been used to transfer DNA into a variety of different LAB as an easy and rapid method compared to most other methods for the transfer of plasmid DNA to bacteria. Protocols for the electroporation of Leuconostoc have been described (5, 12), and in 1991 these protocols were modified by Wycloff et al. (19) for the electroporation of Leuconostoc mesenteroides subsp. cremoris, L. mesenteroides subsp. dextranicum, and Leuconostoc lactis. However, until now, no protocol has been described for L. carnosum.The aim of the present study was to develop a DNA transformation protocol for L. ca...

Significance of Heme-Based Respiration in Meat Spoilage Caused by Leuconostoc gasicomitatum

“…The PCR fragment was cleaved with EcoRI and HindIII and cloned into the plasmid pSIP256 to generate the plasmid pSIP1333A. Plasmid pSIP1333A was used to transform L. gasicomitatum LMG18811 T , essentially according to the method of Helmark et al (18), selecting for erythromycin (3 g ml Ϫ1 ) resistance. Transformants were checked by PCR using external PCR primers cydA2 (GGTGGTGTGATGGTTTGGTT) and cydC2 (ACCGCCTTGTCAGCA TAAAC).…”

Improved Electrotransformation and Decreased Antibiotic Resistance of the Cystic Fibrosis Pathogen Burkholderia cenocepacia Strain J2315

“…Using the protocol described in Materials and Methods, we were able to transform J2315 with plasmid DNA extracted from wild-type E. coli. As with L. carnosum (13), the duration of phenotypic expression before selection is important. Few or no transformants were obtained if electroporated cells were incubated for times shorter than 2 h; the number of transformants per viable cell was 2.5-to 5-fold higher at 4 h than at 2 h, and extending incubation to 6 h or more did not further increase this ratio.…”

“…The standard E. coli electrotransformation procedure yielded no transformants when it was applied to B. cenocepacia. Because Grampositive bacteria are more refractory to electrotransformation than Gram-negative bacteria, we adapted a protocol designed for the Gram-positive Leuconostoc carnosum 4010 (13). The main differences of this protocol from the E. coli procedure are as follows: (i) inoculation of the culture at a lower cell density, (ii) fewer generations of growth before harvesting, (iii) addition of glycine to the culture medium, (iv) gentle centrifugation and resuspension during cell washing, and (iv) longer phenotypic expression.…”

lfnA from Pseudomonas aeruginosa O12 and wbuX from Escherichia coli O145 Encode Membrane-Associated Proteins and Are Required for Expression of 2,6-Dideoxy-2-Acetamidino- l -Galactose in Lipopolysaccharide O Antigen

“…Transformation of plasmid DNA into P. aeruginosa O12 strain ATCC 33359 using standard electroporation protocols usually employed for P. aeruginosa (18,23,55) has proven to be difficult. To alleviate this problem, we developed a novel method for preparation of electrocompetent P. aeruginosa by combining steps from two methods in the literature (13,32). Cells were grown according to the method of Helmark and coworkers (32) but harvested at room temperature according to the protocol of Choi and coworkers (13).…”