Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Abstract

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α^3.7/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Next‐generation sequencing improves molecular epidemiological characterization of thalassemia in Chenzhou Region, P.R. China

“…IVS‐I‐117 (G>A) was a rare mutation which was firstly reported in Indian population . And HBA2:c.95+5_95+28delGGCTCCCTCCCCTGCTCCGACCCG was only reported once in Malaysia . Interestingly, HBA2:c.184A>T(Lys>End) was a recently reported novel mutation which was also found by NGS in Guangdong Province, China .…”

Evidence of New Intragenic HBB Haplotypes Model for the Prediction of Beta-Thalassemia in the Malaysian Population

“…Hence, the survival rate of patients with thalassemia in Malaysia has improved 6 . With several molecular studies have been done previously in the East and West Malaysia, genetic heterogeneity is more observed in multiracial population in Malaysia with a diverse spectrum of alpha (α-), beta (β-) and delta (δ-) globin genes mutations among the patients with thalassemia syndromes [7][8][9][10][11] . Beta-thalassemia is due to decreased beta-globin chain synthesis of which, caused by a mutation in the HBB gene.…”

A novel gap-PCR with high resolution melting analysis for the detection of α-thalassaemia Southeast Asian and Filipino β0-thalassaemia deletion

“…In this study, the HRM analysis developed for detection of the β-FIL deletion showed 100% specificity and sensitivity. As the Filipino β 0 -thalassaemia deletion was reported to be present in a high frequency in the indigenous groups in East Malaysia 7 8 9 , molecular screening for this defect should be implemented in order to prevent the birth of β-thalassaemia major children. It is even more pertinent that screening for the β-FIL deletion be carried out as the majority of these individuals are not aware that they are thalassaemia carriers due to their isolation from towns and limited medical care.…”

“…Gap-PCR was performed to detect the α-SEA and β-FIL deletions using a Veriti thermal cycler (Applied Biosystems, USA). The total reaction volume for gap-PCR was 25 μl which contained 10X PCR buffer, 2.5 U Taq DNA polymerase (Fermentas, Germany), 800 μM of dNTP, 20 pmol for each primer, 2.5 mM magnesium chloride (MgCl 2 ) 7 9 . The cycling conditions for the α-SEA deletion involved 95 °C for 5 minutes, followed by 30 cycles of denaturation at 93 °C for 1 minute, annealing at 60 °C for 1 minute and extension at 72 °C for 1.5 minutes, and finally an extension step at 72 °C for 6 minutes.…”

“…A high incidence (12.8%) of the β-FIL deletion was also reported in the Kadazandusun population 8 . In another study in the indigenous groups in Northern Sarawak, the β-FIL deletion accounted for 26/28 (93%) of the β-thalassemia alleles in transfusion-dependent thalassaemia patients 9 .…”