Transition-metal complexes as catalysts of active oxygen species formation in autooxidation reactions

Vol'pin, M. E.; Krainova, N. Yu.; Moskaleva, I. V.; Novodarova, G. N.; Vorozhtsov, Georgy N.; Gal'pern, M. G.; Kaliya, O. L.; Luk’yanets, E. A.; Mikhalenko, S. A.

doi:10.1007/bf01457796

Cited by 4 publications

(2 citation statements)

References 5 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This made it possible to initiate studies of complexes of iron phthalocyanines and their conjugates with proteins, DNA and RNA as potential drugs in catalytic (dark) therapy of cancer. 21,227,228 In addition, high antihistamine and antiserotonin activities of PcFe derivatives were observed in a number of studies. 5,229 The use of these compounds as deodorising agents is based on their high oxidase activity.…”

Section: Major Fields Of Application Of Iron Phthalocyanines and Thei...mentioning

confidence: 99%

Synthesis, structure and properties of coordination compounds of iron phthalocyanines and their analogues

et al. 2000

View full text Add to dashboard Cite

Section: Major Fields Of Application Of Iron Phthalocyanines and Thei...mentioning

confidence: 99%

Synthesis, structure and properties of coordination compounds of iron phthalocyanines and their analogues

et al. 2000

View full text Add to dashboard Cite

“…These species damage different biomolecules [10]. The complex of phthalocyanine with Co(II) is known to be one of the most effective catalysts in the oxidation of different substrates with molecular oxygen and hydrogen peroxide [11]. …”

Section: Introductionmentioning

confidence: 99%

Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Chernonosov

Koval²,

Knorre³

et al. 2006

Bioinorganic Chemistry and Applications

View full text Add to dashboard Cite

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen , while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.

show abstract

Mark Efimovich Vol'pin: The path to science

Akhrem

1998

Russ Chem Bull

View full text Add to dashboard Cite

Transition-metal complexes as catalysts of active oxygen species formation in autooxidation reactions

Cited by 4 publications

References 5 publications

Synthesis, structure and properties of coordination compounds of iron phthalocyanines and their analogues

Synthesis, structure and properties of coordination compounds of iron phthalocyanines and their analogues

Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Mark Efimovich Vol'pin: The path to science

Contact Info

Product

Resources

About