Transmembrane Interactions Are Needed for KAI1/CD82-Mediated Suppression of Cancer Invasion and Metastasis

Abstract

In transmembrane (TM) domains, tetraspanin KAI1/ CD82 contains an Asn, a Gln, and a Glu polar residue. A mutation of all three polar residues largely disrupts the migration-, invasion-, and metastasis-suppressive activities of KAI1/CD82. Notably, KAI1/CD82 inhibits the formation of microprotrusions and the release of microvesicles, while the mutation disrupts these inhibitions, revealing the connections of microprotrusion and microvesicle to KAI1/CD82 function. The TM polar residues are needed for proper interactions between KAI1/CD82 and tetraspanins CD9 and CD151, which also regulate cell movement, but not for the association between KAI1/CD82 and ␣3␤1 integrin. However, KAI1/CD82 still efficiently inhibits cell migration when either CD9 or CD151 is absent. Hence, KAI1/CD82 interacts with tetraspanin and integrin by different mechanisms and is unlikely to inhibit cell migration through its associated proteins. Moreover, without significantly affecting the glycosylation, homodimerization, and global folding of KAI1/CD82, the TM interactions maintain the conformational stability of KAI1/CD82, evidenced by the facts that the mutant is more sensitive to denaturation and less associable with tetraspanins and supported by the modeling analysis. Thus, the TM interactions mediated by these polar residues determine a conformation either in or near the tightly packed TM region and this conformation and/or its change are needed for the intrinsic activity of KAI1/CD82. In contrast to immense efforts to block the signaling of cancer progression , the perturbation of TM interactions may open a new avenue to prevent cancer invasion and metastasis.

Significant functional heterogeneity among KIR2DL1 alleles and a pivotal role of arginine245

“…34,35 In addition, the idea of polar residues in the transmembrane domain forming a multisubunit complex and interacting with oppositely charged amino acids has precedence in other biologic systems. 23,36 Therefore, it is reasonable to predict that arginine at position 245 in the transmembrane domain of KIR2DL1 may form multisubunit complexes by interacting with other proteins that are important for its function. On the other hand, cysteine has also been shown to play an important role in the function of many other proteins by forming a disulfide bond.…”

“…Separated proteins were blotted with goat anti-␤-arrestin 2 (Abcam) and rabbit anti-Src-homology-2 domain-containing protein tyrosine phosphatase 2 (SHP-2; Cell Signaling Technologies) antibodies using a Western blotting protocol as described previously. 23 The membrane was stripped with Restore Plus Western Blot Stripping Buffer (Thermo Scientific) and reblotted with anti-FLAG antibody (Sigma-Aldrich) to use as a loading control. For personal use only.…”

CD151 Reinforces Vascular Stability by Balancing Endothelial Cell Adhesion and Cytoskeletal Tension

“…A retrovirus-delivered shRNA system, which has been developed to knockdown human CD151 expression in a highly specific manner 79,148 , was used in this study to establish stably CD151-silenced endothelial cells. As shown in Figure 2-1, the CD151-silencing (CD151 KD) pSIREN construct contains a shRNA-expressing cassette targeting the sequence "AGTACCTGCTGTTTACCTACA" in exon 2 of human CD151 transcript, and the non-silencing (MOCK) construct contains a sequence "GCGAGACCATGCCTCCAACAT" which is homologous to sequence in the exon 6 of human CD151 mRNA but does not have gene silencing effect.…”

“…As shown in Figure 2-1, the CD151-silencing (CD151 KD) pSIREN construct contains a shRNA-expressing cassette targeting the sequence "AGTACCTGCTGTTTACCTACA" in exon 2 of human CD151 transcript, and the non-silencing (MOCK) construct contains a sequence "GCGAGACCATGCCTCCAACAT" which is homologous to sequence in the exon 6 of human CD151 mRNA but does not have gene silencing effect. 79,148 To produce CD151 KD and MOCK shRNA construct-containing retroviruses, equal amount of pSIREN construct and pVSV-G retroviral coat protein expression vector were co-transfected with into GP2-293 retroviral packaging cells using transfection reagent Lipofectamine 2000 The CD151-silencing (CD151 KD) shRNA sequence targets the sequence "AGTACCTGCTGTTTACCTACA" in exon 2 of human CD151 transcript. The non-silencing (MOCK) shRNA sequence "GCGAGACCATGCCTCCAACAT" is homologous to sequence in the exon 6 of human CD151 mRNA but does not have gene silencing effect.…”

“…[145][146][147] A retrovirus-delivered shRNA system has been reported to knockdown CD151 expression in cancer cells in a highly specific manner. 79,148 Using this system, we generated stable CD151-silenced endothelial cells and investigated the functions of CD151 in vascular morphogenesis. Furthermore, we isolated primary lung endothelial cells from CD151-null mice and used these cells in this study to substantiate our findings.…”