Transmission of a fatal clonal tumor by biting occurs due to depleted MHC diversity in a threatened carnivorous marsupial

Abstract

A fatal transmissible tumor spread between individuals by biting has emerged in the Tasmanian devil (Sarcophilus harrisii), a carnivorous marsupial. Here we provide genetic evidence establishing that the tumor is clonal and therefore foreign to host devils. Thus, the disease is highly unusual because it is not just a tumor but also a tissue graft, passed between individuals without invoking an immune response. The MHC plays a key role in immune responses to both tumors and grafts. The most common mechanism of immune evasion by tumors is down-regulation of classical cell surface MHC molecules. Here we show that this mode of immune escape does not occur. However, because the tumor is a graft, it should still be recognized and rejected by the host's immune system due to foreign cell surface antigens. Mixed lymphocyte responses showed a lack of alloreactivity between lymphocytes of different individuals in the affected population, indicating a paucity of MHC diversity. This result was verified by genotyping, providing a conclusive link between a loss of MHC diversity and spread of a disease through a wild population. This novel disease arose as a direct result of loss of genetic diversity and the aggressive behavior of the host species. The neoplastic clone continues to spread although the population, and, without active disease control by removal of affected animals and the isolation of diseasefree animals, the Tasmanian devil faces extinction.conservation genetics ͉ Tasmanian devil ͉ wildlife disease ͉ immune evasion

Immunologically silent cancer clone transmission from mother to offspring

“…However, given the large size of the 6p deletion, it is possible that other gene losses could have contributed to the apparent lack of immuno-surveillance. Other unusual situations where cancer cell transmission occurs all appear to involve immunological invisibility (14): inter-monozygotic twin transmission in utero (4), immunosuppressed recipients of cancer-infiltrated donor organs (15), downregulated MHC antigen expression in venereal sarcoma in dogs (2), and lack of MHC diversity in the Tasmanian devil (Sarcophilus harrisii) with transmissible facial tumors (16). In a recent report (17), loss of allorecognition of leukemic cell HLA by T cells, in a transplant context, also occurred by acquired uniparental disomy of chromosome 6p in the leukemic cells, as in the present study.…”

Reversible epigenetic down-regulation of MHC molecules by devil facial tumour disease illustrates immune escape by a contagious cancer

“…Briefly, devil IFN-γ was identified in the Tasmanian devil genome sequence (ref. 16; www.ensembl.org/Sarcophilus_harrisii; Location: GL861606. 1:1664620-1670021:1) and amplified by using the following primers (F -5′ AGCGGATCCGCCATGAATTATTCAAGCTACCTCTTAGC 3′ and R -5′ TATCTC-TAGATTACTGTGTGATTTTTCCTTGGCTTTT 3′).…”

“…It has been proposed that DFTD successfully passes as an allograft due to low genetic diversity at MHC genes (16). This view has been supported by evidence for expression of MHC genes in tumor cell lines and biopsies (16,17), intact antigen presentation genes in the tumor genome (18), and a lack of tumor infiltrating lymphocytes (19). However, devils are not monomorphic at MHC (20,21), so reduced MHC genetic diversity cannot explain the sustained lack of immune response to the tumor.…”

Disease and the dynamics of extinction

“…Tasmanian DFTD is threatening a species that, until the appearance of disease, appeared to be secure and increasing in numbers. However, extremely low genetic diversity, possibly as a result of a previous selective sweep [47,73], has predisposed the species to be susceptible to an allograft.…”