Transport of Na+ and K+ by an antiporter-related subunit from the Escherichia coli NADH dehydrogenase I produced in Saccharomyces cerevisiae

Abstract

The NADH dehydrogenase I from Escherichia coli is a bacterial homolog of the mitochondrial complex I which translocates Na + rather than H + . To elucidate the mechanism of Na + transport, the C-terminally truncated NuoL subunit (NuoL N ) which is related to Na + /H + antiporters was expressed as a protein A fusion protein (ProtANuoL N ) in the yeast Saccharomyces cerevisiae which lacks an endogenous complex I. The fusion protein inserted into membranes from the endoplasmatic reticulum (ER), as conWrmed by diVerential centrifugation and Western analysis. Membrane vesicles containing ProtA-NuoL N catalyzed the uptake of Na + and K + at rates which were signiWcantly higher than uptake by the control vesicles under identical conditions, demonstrating that ProtA-NuoL N translocated Na + and K + independently from other complex I subunits. Na + transport by ProtA-NuoL N was inhibited by EIPA (5-(N-ethyl-N-isopropyl)-amiloride) which speciWcally reacts with Na + /H + antiporters. The cation selectivity and function of the NuoL subunit as a transporter module of the NADH dehydrogenase complex is discussed.

The Membrane Subunit NuoL(ND5) Is Involved in the Indirect Proton Pumping Mechanism of Escherichia coli Complex I

“…Thus it is likely that 333 AFF in NuoL could be an EIPA binding site. This assumption can well be supported by previous reports: (i) the photoaffinity labeling of the bovine ND5 subunit by the fenpyroximate analog was almost completely blocked by EIPA (18); (ii) reconstituted C-terminally truncated E. coli NuoL subunit (NuoL(N)) facilitated the uptake of Na ϩ into the proteoliposomes, and this Na ϩ uptake was inhibited by EIPA (62); (iii) the Na ϩ uptake by membrane vesicles containing overexpressed Protein A fused NuoL(N) from the yeast Saccharomyces cerevisiae endoplasmic reticulum was inhibited by EIPA (63).…”

Organelle-specific expression of subunit ND5 of human complex I (NADH dehydrogenase) alters cation homeostasis in Saccharomyces cerevisiae

“…Escherichia coli K‐12 strain DH5α or BL21 (DE3) (Hanahan, 1983) (MBI Fermentas) served as the host for the amplification of plasmids that conferred ampicillin resistance. The synthetic MT‐ND5 gene (Eurofins Medigenomix) was cloned into plasmid pNLt1 (Gemperli et al , 2007) at SalI restriction sites. The sfgfp gene encoding for an engineered superfolding green fluorescent protein (GFP) (Pedelacq et al , 2006) was amplified using the PCR primers 5′‐AAAATAGCGGCCGC ACTAGTATGAGCAAAGGAG ‐3′ (forward) and 5′‐TCAGCCGAATTC TTGTAGAGTTCATCCATGCCATG ‐3′ (reverse) and inserted at NotI and EcoRI restriction sites of pNLt1 to generate plasmid pG5N (Table 1).…”

“…This strain is furthermore deficient in endoproteinases A and B, which diminishes proteolytic degradation (Jones, 1991). Cells were grown as described previously (Gemperli et al , 2007). GAL1 ‐controlled expression of the ND5 fusion proteins was induced by transfer to minimal YNB medium (0.67% yeast–nitrogen base with supplementary amino acids and adenine) containing 2% galactose for 27 h (mid‐log phase) before harvesting.…”

“…Cell debris was removed by centrifugation for 5 min at 4000 g . Membranes from the ER and the nuclear envelope were obtained as described in Gemperli et al (2007). Mitochondria were isolated as described in Meisinger et al (2006).…”

A cytochrome c fusion protein domain for convenient detection, quantification, and enhanced production of membrane proteins in Escherichia coli—Expression and characterization of cytochrome‐tagged Complex I subunits

“…20 The whole NuoL, fused with a protein A domain, has thereafter been produced in yeast endoplasmatic reticulum with seemingly retained functionality. 21 Other studies of the NuoL, NuoM, or NuoN subunit function have been performed by modifying the chromosomally located genes. [22][23][24][25] Here, we present protein constructs where the C-terminal end of the Complex I subunits NuoH, NuoL, NuoM, and NuoN from E. coli have been genetically fused to a cytochrome c domain (Fig.…”