TRIB3 Stabilizes High TWIST1 Expression to Promote Rapid APL Progression and ATRA Resistance

Abstract

Purpose: The resistance to differentiation therapy and early death caused by fatal bleeding endangers the health of a significant proportion of patients with acute promyelocytic leukemia (APL). This study aims to investigate the molecular mechanisms of all-trans retinoic acid (ATRA) resistance and uncover new potential therapeutic strategies to block the rapid progression of early death. Experimental Design: The important role of TWIST1 in APL leukemogenesis was first determined by gain-and lossof-function assays. We then performed in vivo and in vitro experiments to explore the interaction of TWIST1 and TRIB3 and develop a potential peptide-initiated therapeutic opportunity to protect against early death and induction therapy resistance in patients with APL. Results: We found that the epithelial-mesenchymal transition (EMT)-inducing transcription factor TWIST1 is highly expressed in APL cells and is critical for leukemic cell survival. TWIST1 and TRIB3 were highly coexpressed in APL cells compared with other subtypes of acute myeloid leukemia cells. We subsequently demonstrated that TRIB3 could bind to the WR domain of TWIST1 and contribute to its stabilization by inhibiting its ubiquitination. TRIB3 depletion promoting TWIST1 degradation reverses resistance to induction therapy and improves sensitivity to ATRA. On the basis of a detailed functional screen of synthetic peptides, we discovered a peptide analogous to the TWIST1 WR domain that specifically represses APL cell survival by disrupting the TRIB3/TWIST1 interaction. Conclusions: Our data not only define the essential role of TWIST1 as an EMT-TF in patients with APL but also suggest that disrupting the TRIB3/TWIST1 interaction reverses induction therapy resistance and blocks rapid progression of APL early death. See related commentary by Peeke and Gritsman, p. 6018

Elevated TWIST1 expression in myelodysplastic syndromes/acute myeloid leukemia reduces efficacy of hypomethylating therapy with decitabine

“…J. Xu's group reported recently that TWIST1 is involved in arsenic trioxide resistance in acute promyelocytic leukemia (APL) patients. 11 This observation and ours, taken together, suggest possible association of aberrant TWIST1 expression with therapeutic failure in hematopoietic malignancies. Our detailed analysis reveals that TWIST1 can interact with both wild-type and mutated DNMT3a and disrupt DNMT3a/TWIST1 interaction can block induction of DAC resistance.…”

RBCK1‐TRIB3 decelerated the progression of acute promyelocytic leukemia

“…Strikingly, RBCK1‐TRIB3 was identified in pre‐APL (collected at 19 October 2018) but not overt‐APL sample (collected at 22 January 2020/1/22) (Tables S1 and S2), and this result was also confirmed by RT‐PCR (primers: forward 5′‐TATGGCTTCCCACCAGTCTT‐3′, reverse 5′‐CTTCGAGCTCGTTTCTGGAC‐3′) (Figure 1L). It has been reported that TRIB3 promoted APL progression via stabilizing PML‐RARA 4,5 . In RBCK1‐TRIB3 , the breakpoint located at the exon 4 of RBCK1 and the exon 2 of TRIB3 (Figure 1M).…”

“…It has been reported that TRIB3 promoted APL progression via stabilizing PML-RARA. 4,5 In RBCK1-TRIB3, the breakpoint located at the exon 4 of RBCK1 and the exon 2 of TRIB3 (Figure 1M). Due to the out-frame fusion, RBCK1-TRIB3 was premature terminated and the TRIB3 portion was completely lost.…”

TRAF6 Suppresses the Development of Pulmonary Fibrosis by Attenuating the Activation of Fibroblasts

“…These data indicated that the decreased protein expression of TRAF6 in lung fibroblasts during PF progression might result from an alteration in its protein stability. Our group, along with others, has reported that TRIB3, a well-known stress sensor, is involved in regulating the stability of various proteins in the pathogenesis of chronic diseases ( Lin et al, 2019 ; Yu J. M. et al, 2019 ; Liu S. et al, 2021 ). We then reasoned that TRIB3 might participate in regulating the altered protein expression of TRAF6.…”

“…TRIB3, a stress sensor, is involved in the pathogenesis of various diseases, including obesity, diabetes, and tumors ( Du et al, 2003 ; Oberkofler et al, 2010 ; Lin et al, 2019 ). Accumulating evidence has widely demonstrated that TRIB3 plays a vital role in organ fibrogenesis ( Wang et al, 2014 ; Tomcik et al, 2016 ; Zhang et al, 2020 ).…”