Trichloroethylene Disrupts Cardiac Gene Expression and Calcium Homeostasis in Rat Myocytes

Abstract

We have been investigating the molecular mechanisms by which trichloroethylene (TCE) might induce cardiac malformations in the embryonic heart. Previous results indicated that TCE disrupted expression of genes encoding proteins involved in regulation of intracellular Ca2+, [Ca2+](i), in cardiac cells, including ryanodine receptor isoform 2 (Ryr2), and sarcoendoplasmatic reticulum Ca2+ ATPase, Serca2a. These observations are important in light of the notion that altered cardiac contractility can produce morphological defects. The hypothesis tested in this study is that the TCE-induced changes in gene expression of Ca2+-associated proteins resulted in altered Ca2+ flux regulation. We used real-time PCR and digital imaging microscopy to characterize effects of various doses of TCE on gene expression and Ca2+ response to vasopressin (VP) in rat cardiac H9c2 myocytes. We observed a reduction in Serca2a and Ryr2 expression at 12 and 48 h after exposure to TCE. In addition, we found significant differences in Ca2+ response to VP in cells treated with TCE doses as low as 10 parts per billion. Taken all together, our data strongly indicate that exposure to TCE disrupts the ability of myocytes to regulate cellular Ca2+ fluxes. Perturbation of calcium signaling alters cardiac cell physiology and signal transduction and may hint to morphogenetic consequences in the context of heart development. These results point to a novel area of TCE biology and, if confirmed in vivo, may help to explain the apparent cardio-specific toxicity of TCE exposure in the rodent embryo.

Trichloroethylene Induces Methylation of the Serca2 Promoter in H9c2 Cells and Embryonic Heart

“…These effects were prevented by methionine, indicating that methyl group availability for DNA methylation was an important factor in mediating the carcinogenicity of TCE in mouse liver. Previously, findings by our laboratory suggested that maternal supplementation with folic acid exacerbated the effects of TCE exposure on the expression levels of genes involved in calcium regulation pathways in both mouse embryonic hearts and rat cardiomyocytes [9]. These cumulative data support the notion that TCE may alter target gene expression by affecting DNA methylation.…”

“…Exposure to TCE has also been associated with increased incidence of congenital heart malformations [4,18,39], although past studies have reported inconsistent results [1,4,15], mainly due to differences in experimental conditions. However, recent data from our and other groups [9,13,14,30,33] have supported the notion that exposure to low, environmentally significant doses of TCE affects physiological heart development in both rodent and chick models. In particular, studies using in vitro and in vivo systems [8,9,34] documented that TCE impaired calcium handling in cardiomyocytes, which is controlled largely by the calcium ATPase, Serca2a.…”

“…However, recent data from our and other groups [9,13,14,30,33] have supported the notion that exposure to low, environmentally significant doses of TCE affects physiological heart development in both rodent and chick models. In particular, studies using in vitro and in vivo systems [8,9,34] documented that TCE impaired calcium handling in cardiomyocytes, which is controlled largely by the calcium ATPase, Serca2a. This finding suggests that disruption of calcium signaling with consequent alterations in cardiac cell physiology and signal transduction may lead to morphogenetic changes and alter heart development.…”

“…More recently, we showed that TCE doses ranging from 10 ppb to 10 ppm reduced the expression and function of Serca2a in rat myoblasts, H9c2 cells [9]. Findings by Tao et al [37,38] indicated TCE-induced hypomethylation of the proto oncogenes c-myc and c-jun in mouse liver, which in turn stimulate cell proliferation and the development of liver tumors.…”

Adjuvant arthritis influences expression of housekeeping genes

“…higher stability, obtained for GAPDH come from the nature of the algorithms followed by both programs. GeNORM and NormFinder consider instability when the pattern of the variation of the gene differs from other [14] 18s rRNA GGGAGGTAGTGACGAAAAATAACAAT TTGCCCTCCAATGGATCCT [15] Fig. 1 Average fold changes ±SD (n = 3) in GAPDH, b-actin and 18s rRNA in AA rats in different organs; *p \ 0.05 vs. baseline expression (dotted line).…”