Two-component regulatory systems in Helicobacter pylori and Campylobacter jejuni: Attractive targets for novel antibacterial drugs

Abstract

Two-component regulatory systems (TCRS) are ubiquitous signal transduction mechanisms evolved by bacteria for sensing and adapting to the constant changes that occur in their environment. Typically consisting of two types of proteins, a membrane sensor kinase and an effector cytosolic response regulator, the TCRS modulate via transcriptional regulation a plethora of key physiological processes, thereby becoming essential for bacterial viability and/or pathogenicity and making them attractive targets for novel antibacterial drugs. Some members of the phylum Campylobacterota (formerly Epsilonproteobacteria), including Helicobacter pylori and Campylobacter jejuni, have been classified by WHO as “high priority pathogens” for research and development of new antimicrobials due to the rapid emergence and dissemination of resistance mechanisms against first-line antibiotics and the alarming increase of multidrug-resistant strains worldwide. Notably, these clinically relevant pathogens express a variety of TCRS and orphan response regulators, sometimes unique among its phylum, that control transcription, translation, energy metabolism and redox homeostasis, as well as the expression of relevant enzymes and virulence factors. In the present mini-review, we describe the signalling mechanisms and functional diversity of TCRS in H. pylori and C. jejuni, and provide an overview of the most recent findings in the use of these microbial molecules as potential novel therapeutic targets for the development of new antibiotics.

Structural insights into transcription activation mechanism of the global regulator GlnR from actinobacteria

“…TCSs are ubiquitous in archaea, bacteria, lower eukaryotic organisms and plants but absent in mammals, therefore, bacterial TCSs are promising targets for drug discovery and design (57).…”

“…Two-component systems (TCSs) composed of histidine kinases (HKs) and response regulator (RRs), are regarded as one of the most elaborate and efficient way to successfully fulfil stress adaptation at the transcription level (9,10,12). TCSs are ubiquitous in archaea, bacteria, lower eukaryotic organisms and plants but absent in mammals, therefore, bacterial TCSs are promising targets for drug discovery and design (57). The OmpR/PhoB subfamily transcription factors in bacteria are regarded as typical RRs involved in primary, secondary metabolisms, and have been extensively studied for four decades.…”

Structural basis of DNA recognition of the Campylobacter jejuni CosR regulator

“…In addition, there is strong evidence that C. jejuni CosR modulates the expression of the CmeABC multidrug efflux system ( 21 , 22 ). Therefore, it has been proposed that the C. jejuni CosR regulator is an attractive target for the development of novel anti- Campylobacter drugs ( 23 ). Within the cmeABC promotor, there is a 21 bp DNA sequence TATTAACCAAAATTAAGATAT , containing the predicted regulator binding sites.…”

Combined In Silico and In Vitro Study to Reveal the Structural Insights and Nucleotide-Binding Ability of the Transcriptional Regulator PehR from the Phytopathogen Ralstonia solanacearum

“…These proteins regulate transcription, which, in turn, affects several crucial physiological processes. As a result, they are vital to the survival and pathogenicity of the bacterium, making them desirable targets for cutting-edge antibacterial medications . Although PehR, an ATP-binding regulator, is essential for controlling PG production and motility in R.…”