Two novel missense mutations in the CETP gene in Japanese hyperalphalipoproteinemic subjects: High-throughput assay by Invader® assay

Abstract

Cholesteryl ester transfer protein (CETP) deficiency is one of the most important and common causes of hyperalphalipoproteinemia (HALP) in the Japanese. CETP deficiency is thought to be a state of impaired reverse cholesterol transport, which may possibly lead to the development of atherosclerotic cardiovascular disease despite high HDL-cholesterol (HDL-C) levels. Thus, it is important to investigate whether HALP is caused by CETP deficiency. In the present study, we identified two novel missense mutations in the CETP gene among 196 subjects with a marked HALP (HDL-C ജ 2.59 mmol/l ‫؍‬ 100 mg/dl). The two missense mutations, L151P (CTC → CCC in exon 5) and R282C (CGC → TGC in exon 9), were found in compound heterozygous subjects with D442G mutation, whose plasma CETP levels were significantly lower when compared with those in D442G heterozygous subjects. In COS-7 cells expressing the wild type and mutant CETP, these two mutant CETP showed a marked reduction in the secretion of CETP protein into media (0% and 39% of wild type for L151P and R282C, respectively). These results suggested that two novel missense mutations cause the decreased secretion of CETP protein into circulation leading to HALP. By using the Invader ® assay for seven mutations, including two novel mutations of the CETP gene, we investigated their frequency among 466 unrelated subjects with HALP (HDL-C ജ 2.07 mmol/l ‫؍‬ 80 mg/dl). Two novel mutations were rare, but L151P mutation was found in unrelated subjects with a marked HALP.Furthermore, we demonstrated that CETP deficiency contributes to 61.7% and 31.4% of marked HALP and moderate HALP in the Japanese, respectively. Reverse cholesterol transport (RCT) is one of the major protective systems against atherosclerosis, in which small HDL or free apolipoprotein (apo)A-I removes cholesterol from the peripheral cells and delivers it to the liver (1, 2). We have investigated the molecular mechanisms of RCT by analyzing the pathophysiology of subjects with abnormal HDL metabolism and clarified the physiological significance of plasma cholesteryl ester transfer protein (CETP) and hepatic triglyceride lipase in human RCT (3,4). In this system, CETP is known to facilitate the transfer of cholesteryl ester (CE) from HDL to apoB-containing lipoproteins, and is one of the major determinants of plasma HDL-cholesterol (HDL-C) levels in humans (5)(6)(7)(8). This is true especially in the hypertriglyceridemic subjects (9). Furthermore, CETP affects not only plasma HDL-C levels but also the amount of small HDL particles, which may be more important for RCT (8,10).Genetic CETP deficiency is the most important and frequent cause of hyperalphalipoproteinemia (HALP) in the Japanese (11-21). Seven mutations have been demonstrated to cause HALP, including two common mutations: a G-to-A substitution at the 5 Ј splicing donor site of the intron 14 (Int14 ϩ 1 G → A) and a missense mutation of exon Abbreviations: BPI, bactericidal permeability increasing protein; CE, cholesteryl ester; CETP, cholesteryl ester tra...

Novel mutations of cholesteryl ester transfer protein (CETP) gene in Japanese hyperalphalipoproteinemic subjects

“…Many CETP gene mutations are reported, such as nonsense mutations (n=8), splice junction mutations (n=6), missense mutations (n=5), small gene deletions and insertions (n=4), promoter mutations (n=2) and others (n=1) (Fig.6) [8,9,20,[27][28][29][30][31][32][33][34][35][36][37][38][39][40][41][42][43][44][45][46]. In the present study, we identified c.653_654delGGinsAAAC and c.658G>A from several subjects with HALP, and it suggests that nonsense and splicing defect mutations account for the majority of CETP gene mutations.…”

An oxidized low‐density lipoprotein receptor gene variant is inversely associated with the severity of coronary artery disease

“…10 After genomic DNA was extracted from blood samples, the region (491 bp) containing the polymorphic site was amplified by polymerase chain reaction (PCR), as previously reported, 9 and PCR products were used for Invader assay according to our protocol. 11 The primary probes (probe 1 for C allele, acggacgcggagcttttcccagttaaatgagc, and probe 2 for G allele, cgcgccgagggttttcccagttaaatgagc) and the Invader probe (tggcatccaaagacaagcacttctcttggctt) were designed using the Invader Creator software package to obtain a theoretical annealing temperature of 63ºC and 77ºC, respectively. After putting the probes, PCR products, and MgCl 2 into the reaction wells of FRET detection plates, they were incubated at 63ºC for 30 min.…”

“…The concordance rate of genotyping between Invader assay and PCR-restriction fragment length polymorphism analysis was 100% for 980 samples in our previous reports. 11,13 …”

“…However, no association between this polymorphism and coronary artery disease (CAD) has yet been elucidated. Using the Invader assay, 10,11 we investigated the association between LOX-1 gene polymorphism and CAD in 586 patients undergoing coronary angiography. To examine whether this polymorphism affects the metabolism of oxidized LDL, we also assessed serum malondialdehyde-modified LDL (MDA-LDL) levels, one of oxidized LDLs, using a recently developed sensitive enzyme-linked immunosorbent assay (ELISA).…”

Polymorphisms in Four Genes Related to Triglyceride and HDL-cholesterol Levels in the General Japanese Population in 2000

“…Among the several polymorphisms we selected, -514C → T, located in the promoter region of the LIPC gene, has been demonstrated to influence LIPC activity levels (22). Apolipoprotein CIII (apoCIII) can inhibit LPL and reduces the uptake of TG-rich remnant particles and the SstI polymorphism of the APOC3 gene has been shown to be associated with hypertriglyceridemia and CAD in various human populations (23)(24)(25)(26)(27). Therefore, we also examined these polymorphisms in the general Japanese population.…”