Type 1 Immunity Provides Both Optimal Mucosal and Systemic Protection against a Mucosally Invasive, Intracellular Pathogen

Abstract

It has been hypothesized that optimal vaccine immunity against mucosally invasive, intracellular pathogens may require the induction of different types of immune responses in mucosal and systemic lymphoid tissues. Mucosal type 2/3 responses (producing interleukin-4 [IL-4], IL-6 and/or transforming growth factor ␤) could be necessary for optimal induction of protective secretory immunoglobulin A responses. On the other hand, systemic type 1 responses (including gamma interferon [IFN-␥], tumor necrosis factor alpha, and optimal cytotoxic T-cell responses) are likely to be critical for protection against the disseminated intracellular replication that occurs after mucosal invasion. Despite these predictions, we recently found that vaccines inducing highly polarized type 1 immunity in both mucosal and systemic tissues provided optimal mucosal and systemic protection against the protozoan pathogen Trypanosoma cruzi. To further address this important question in a second model system, we now have studied the capacity of knockout mice to develop protective immune memory. T. cruzi infection followed by nifurtimox treatment rescue was used to immunize CD4, CD8, ␤2-microglobulin, inducible nitric oxide synthase (iNOS), IL-12, IFN-␥, and IL-4 knockout mice. Despite the previously demonstrated importance of CD4 ؉ T cells, CD8 ؉ T cells, and nitric oxide for T. cruzi immunity, CD4, CD8, and iNOS knockout mice developed mucosal and systemic protective immunity. However, IL-12, IFN-␥, and ␤2-microglobulin-deficient mice failed to develop mucosal or systemic protection. In contrast, IL-4 knockout mice developed maximal levels of both mucosal and systemic immune protection. These results strongly confirm our earlier conclusion from studies with polarizing vaccination protocols that type 1 immunity provides optimal mucosal and systemic protection against a mucosally invasive, intracellular pathogen.

Perforin and Gamma Interferon Expression Are Required for CD4+and CD8+T-Cell-Dependent Protective Immunity against a Human Parasite,Trypanosoma cruzi, Elicited by Heterologous Plasmid DNA Prime-Recombinant Adenovirus 5 Boost Vaccination

“…Vaccination studies confirmed these observations by providing evidence that CD8 ϩ T cells are particularly important to the development of protective immunity in mice immunized with recombinant plasmid DNA, proteins, or viruses (6,19,25,31,37,43,60). In addition to CD8 ϩ T cells, CD4 ϩ Th1 cells also play a role in immunity against T. cruzi after vaccination with plasmid DNA or recombinant protein (19,30,60).…”

Heterologous Plasmid DNA Prime-Recombinant Human Adenovirus 5 Boost Vaccination Generates a Stable Pool of Protective Long-Lived CD8 + T Effector Memory Cells Specific for a Human Parasite, Trypanosoma cruzi

“…This result should be interpreted with caution, however, because it would be impossible to attribute the high susceptibility of the IL-12/IL-23 (p40) KO mice only to a defect of specific CD8 ϩ T cells. The absence of this cytokine impairs a number of other immunological functions, including the expansion of Th1 CD4 ϩ T cells and NKT and NK cells, all of which actively participate during the immune response to T. cruzi infection (7,15,23,30,42).…”

Intranasal Vaccinations with the trans -Sialidase Antigen plus CpG Adjuvant Induce Mucosal Immunity Protective against Conjunctival Trypanosoma cruzi Challenges

“…To characterize the immune responses induced by intranasal vaccination, we measured antigen-specific proliferative responses and IFN-␥ production. Briefly, two doses of recombinant TS or negative control phage 10 (NC) protein (50 g) adjuvanted with CpG 1826 (10 g) were administered intranasally to BALB/c mice 1 week apart, as previously described (10). One month after the final vaccination, mice were challenged via contamination of the ocular surface with 3 ϫ 10 5 CMT as described previously (8).…”

“…Six-to 8-week-old BALB/c mice were immunized intranasally twice, 1 week apart, with either 50 g recombinant trans-sialidase (TS) protein or 50 g phage 10 protein as a negative control (NC) and 10 g CpG 1826 as previously described (10). All preparations of recombinant TS and phage 10 protein contained less than 15 endotoxin units/mg of protein.…”

“…DNA samples were purified using a DNeasy kit (Qiagen, San Diego, CA), and total DNA concentrations were adjusted to 20 to 40 ng/ml. Primers (5ЈAACCACCACGACAACCACAA3Ј and 5ЈTGCAGGACATCTGC ACAAAGTA3Ј) were used to specifically amplify a 65-bp fragment of cruzipain, with a protocol similar to one we have previously described (10). However, instead of using Sybr green detection as in our previous method, amplicon generation was detected using a 6-carboxyfluorescein (FAM)/N,N,NЈ,NЈ-tetramethyl-6-carboxyrhodamine (TAM) probe (5ЈTGCCCCAGGACCGTCCCCA 3Ј) (Synthegen, Houston, TX), TaqMan PCR master mix (Applied Biosystems, Foster City, CA), 900 nM each primer, and 100 to 200 ng of sample DNA.…”