Type I C1 inhibitor deficiency with a small messenger RNA resulting from deletion of one exon.

Abstract

The molecular genetic basis of C1 inhibitor (Cl INH) deficiency in a patient with type I hereditary angioneurotic edema was studied. This patient was found to have an abnormally short C1 INH mRNA together with a normal message. Restriction fragment length polymorphism of the Cl INH gene was detected by Southern blot analysis of the patient's DNA after digestion with Pst I or Sac I, and hybridization with a full-length C1 INH cDNA. Hybridization of the same blot with three different fragments of the full-length cDNA suggested that exon VII and portions of both flanking introns were deleted in the C1 INH gene. Northern blot analysis of RNA from cultured monocytes, using a probe corresponding to exon VII, also indicated that the abnormal C1 INH mRNA had a deletion of these nucleotides. To confirm the hypothesis that the short C1 INH mRNA contained a deletion, the involved segment of the patient's C1 INH mRNA was amplified using the polymerase chain reaction (PCR). PCR amplification yielded two C1 INH DNA fragments of different lengths (380 and 160 bp). Southern blot and sequence analysis of both DNA fragments clearly revealed that the smaller 160-bp DNA was derived from the abnormal message and had a deletion of nucleotides corresponding to exon VII.

Hereditary angioedema: The mutation spectrum ofSERPING1/C1NHin a large Spanish cohort

“…In both cases, 1 mg of total RNA was amplified in a one-step reaction with the SuperScriptt One-Step RT-PCR with Platinum Taq kit (Invitrogen; Life Technologies, Carlsbad, CA) in a final volume of 50 ml. In order to amplify a fragment from exons 6-8, the forward primer 5 0 aactcagttataaaagtgcccatgatgaat 3 0 [Ariga et al, 1989] and the reverse primer 5 0 gtgctgcatcgcagaaacctgaagatctgg 3 0 were used, and cDNA synthesis was achieved in a 45-min incubation at 501C after a hot start. The amplification of the cDNA was performed using 25 pmol of each primer and 35 cycles in a Perkin Elmer 9700 thermocycler (Applied Biosystems), comprising 15 sec at 941C, 30 sec at 531C, and 1 min at 721C, followed by a final extension of 10 min at 721C.…”

A Review of the Reported Defects in the Human C1 Esterase Inhibitor Gene Producing Hereditary Angioedema Including Four New Mutations

“…Four of the mutations previously had not been reported: (1) The first mutation, in patient P1, is a splice site error at nucleotide 8721, which changes the 3Ј acceptor splice site AG to GG at the end of intron 5 at nucleotide 8721-8722. This patient has a family history of HAE and typical symptoms (C1INH, 8 mg/ dL; normal range, [11][12][13][14][15][16][17][18][19][20][21][22][23][24]. (2) The second mutation, in patient P2, is a single base insertion in exon 3 between nucleotides 2467 and 2468.…”

“…In our patient, a T16827C substitution changes the Phe at amino acid 457 to Leu. This patient has no family history of HAE but typical symptoms; she developed symptoms initially at age 74 (C1INH, 7 mg/dL; normal range, [11][12][13][14][15][16][17][18][19][20][21][22][23][24].…”

Synthesis of C1 inhibitor in fibroblasts from patients with type I and type II hereditary angioneurotic edema.

“…Differences occur between serum levels ofC I INH in types I and II HANE. In most type I patients there is no restriction fragment length polymorphism, but deletions in either exon 4 or exon 7 have been identified in some type I kindreds (3,22,23). In type II HANE, mutations occur mostly in the P1 reactive center at amino acid 444 (24), but may also occur at 251 (Ta kindred) (13).…”