Type specific Real time PCR for detection of human herpes virus 6 in schizophrenia and bipolar patients: a case control study

Yavarian, Jila; Malekshahi, Somaye Shatizadeh; Yavarian, Roya; Yazdani, Shaghayegh; Janani, Leila; Shafiei-Jandaghi, Nazanin Zahra; Kiani, Seyed Jalal; Ahamadkhaniha, HamidReza

doi:10.1186/s12888-015-0662-z

Cited by 8 publications

(4 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The only previous study of HHV-6A/B in brain in mood disorders, by Conejero-Goldberg et al (2003) , identified HHV-6B DNA in one BPD and one CON case in the orbital fontal cortex, using a consensus PCR assay with low sensitivity ( Conejero-Goldberg et al, 2003 ). Other studies using blood samples found an association of serum HHV-6A/B IgG with SCZ in military personnel ( Niebuhr et al, 2008 ), and no difference from controls for HHV-6A and HHV-6B DNA in peripheral blood mononuclear cells ( Yavarian et al, 2015 ). It is difficult to reconcile our findings with previous studies or to explain why we found HHV-6A and HHV-6B more frequently in MDD and BPD compared to SCZ.…”

Section: Discussionmentioning

confidence: 86%

Active HHV-6 Infection of Cerebellar Purkinje Cells in Mood Disorders

et al. 2018

View full text Add to dashboard Cite

Early-life infections and associated neuroinflammation is incriminated in the pathogenesis of various mood disorders. Infection with human roseoloviruses, HHV-6A and HHV-6B, allows viral latency in the central nervous system and other tissues, which can later be activated causing cognitive and behavioral disturbances. Hence, this study was designed to evaluate possible association of HHV-6A and HHV-6B activation with three different groups of psychiatric patients. DNA qPCR, immunofluorescence and FISH studies were carried out in post-mortem posterior cerebellum from 50 cases each of bipolar disorder (BPD), schizophrenia, 15 major depressive disorder (MDD) and 50 appropriate control samples obtained from two well-known brain collections (Stanley Medical Research Institute). HHV-6A and HHV-6B late proteins (indicating active infection) and viral DNA were detected more frequently (p < 0.001 for each virus) in human cerebellum in MDD and BPD relative to controls. These roseolovirus proteins and DNA were found less frequently in schizophrenia cases. Active HHV-6A and HHV-6B infection in cerebellar Purkinje cells were detected frequently in BPD and MDD cases. Furthermore, we found a significant association of HHV-6A infection with reduced Purkinje cell size, suggesting virus-mediated abnormal Purkinje cell function in these disorders. Finally, gene expression analysis of cerebellar tissue revealed changes in pathways reflecting an inflammatory response possibly to HHV-6A infection. Our results provide molecular evidence to support a role for active HHV-6A and HHV-6B infection in BPD and MDD.

show abstract

Section: Discussionmentioning

confidence: 86%

Active HHV-6 Infection of Cerebellar Purkinje Cells in Mood Disorders

et al. 2018

View full text Add to dashboard Cite

show abstract

“…Real‐time Taqman PCR was undertaken using consensus primers detecting both HHV‐6A and HHV‐6B: Primers (HHV6U41‐F4: 5′‐CGGAACATTGTTGAGCAGAAA‐3′, HHV6U41‐R106: 5′‐ AAGAAGAATCCCTTGTCTGGC‐3′) and species‐specific probes (HHV‐6A U41‐ProbeA: FAM‐ CTCTAAGCACGAAATCTTCACATTCGGAAACA‐TAMRA, HHV‐6B U41‐ProbeB: JOE‐CTCTAAGCACGAAATTTTGACATTCGGAAACA‐BHQ1). The thermocycling conditions were as follows: Denaturation at 95°C for 3 minutes, followed by 45 cycles of denaturation at 95°C for 15 seconds, annealing at 55°C for 30 seconds and extension at 60°C for 30 seconds.…”

Section: Methodsmentioning

confidence: 99%

Children infected by human herpesvirus 6B with febrile seizures are more likely to develop febrile status epilepticus: A case‐control study in a referral hospital in Zambia

Tembo

Chandwe

Kabwe

et al. 2018

Journal of Medical Virology

View full text Add to dashboard Cite

show abstract

“…Исполь зовали набор реагентов для проведения ПЦРРВ в при сутствии интеркалирующего красителя SYBR Green I (ООО «Синтол», Россия) и зондов TaqMan. Система для определения ДНК ВГЧ6 в клиническом материале была отработана ранее [9].…”

Section: материалы и методыunclassified

Clinical and epidemiological features of infections caused by HHV-6A and HHV-6B

Lysenkova

Каражас

Рыбалкина

et al. 2018

CMAC

View full text Add to dashboard Cite

Objective. To determine the detection rates of HHV-6A and HHV-6B compared to other herpes viruses in children of different age groups. Materials and Methods. A total of 128 patients with symptoms of respiratory viral infections (RVI) aged from 1 to 16 years and 101 otherwise healthy children. A comprehensive examination of the patients, including ELISA, indirect immunofluorescence assay, rapid culture method, PCR, and determination of nucleotide sequences of HHV-6 was performed. Children positive for HHV-6 markers (antibodies, early and late antigens) and positive for HHV-6 DNA were selected into one group (n=59), of which 14 children aged from 3 to 10 years were healthy and 45 children (<3 years of age [20 children] and ≥3 years of age [25 children]) had clinical manifestations of RVI. Results. The incidence rates of acute HHV-6 infection and HHV-6 reactivation were similar between healthy children and children with RVI symptoms (21.9% each). The active Epstein-Barr Virus (EBV) infection took a second place among examined children: acute EBV infection and EBV reactivation were determined in 19 (14.8%) and 10 (7.8%) children, respectively. The incidence rates of HHV-6A and HHV6B among children with RVI symptoms were similar (55.5% and 42.2%, respectively) whereas HHV-6B was predominant in healthy children (85.7%). The HHV-6A was more common (70%) in children under 3 years of age, but HHV-6B was more frequent (67%) in children aged 3 years and older. The most often initial manifestations of HHV-6A infection were acute fever and catarrhal syndrome; whereas HHV-6B was found more frequently in otherwise healthy children. A sudden exanthema and febrile seizures were significantly more common symptoms in children with HHV-6A infection, whereas tonsillar enlargement with exudate and swollen lymph nodes were observed more frequently in children with HHV-6B infection. Conclusions. HHV-6A more often causes acute infection in children less than 3 years of age, which is characterized by fever, febrile seizures, rash (roseola), and upper respiratory tract infection with significant catarrhal syndrome. HHV-6B more often causes acute infection in children aged 3 years and older and is rarely presented with specific symptoms of HHV-6 infection, such as sudden exanthema and febrile seizures. HHV-6B is characterized by lymphoid tissue proliferation (tonsillar enlargement and lymphadenopathy) and hepatomegaly in all age groups of children.

show abstract

Type specific Real time PCR for detection of human herpes virus 6 in schizophrenia and bipolar patients: a case control study

Cited by 8 publications

References 28 publications

Active HHV-6 Infection of Cerebellar Purkinje Cells in Mood Disorders

Active HHV-6 Infection of Cerebellar Purkinje Cells in Mood Disorders

Children infected by human herpesvirus 6B with febrile seizures are more likely to develop febrile status epilepticus: A case‐control study in a referral hospital in Zambia

Clinical and epidemiological features of infections caused by HHV-6A and HHV-6B

Contact Info

Product

Resources

About