Typing infectious bronchitis virus strains using reverse transcription-polymerase chain reaction and restriction fragment length polymorphism analysis to compare the 3′ 7.5 kb of their genomes

Abstract

Typing infectious bronchitis virus (IBV) strains is useful for implementation of control measures and for understanding the epidemiology and evolution of IBV. The aim of the work reported here was to develop a rapid and sensitive method for typing isolates of IBV, if possible directly from tissues of infected birds. A procedure was developed for differentiation of IBV strains by restriction endonuclease fragment length polymorphism (RFLP) analysis of a 7.5 kb DNA fragment amplified from their genome by reverse transcription-polymerase chain reaction (RT-PCR). This fragment encompassed all of the genes encoding the structural proteins of the virus. Viral RNA was extracted either directly from tissues of diseased birds or from virus propagated in embryonated eggs, and was subjecte'd to RT-PCR. Three different restriction endonucleases, AluI, Sau3AI and MnlI, were used to digest the 7.5 kb PCR product from different IBV strains and the resultant RFLP patterns were compared. Patterns obtained with all three enzymes grouped IBV strains belonging to the same serotype in the same cluster. These results show that the RT-PCRÁ/RFLP system described here can be used as a quick and inexpensive tool for differentiating IBV strains.

Coronavirus avian infectious bronchitis virus

“…IB is virtually a global disease [24,39,40,65,67,89,90]. The virus is highly infectious, presumed to spread by aerosol as well as by mechanical means.…”

Evaluation of a novel strain of infectious bronchitis virus emerged as a result of spike gene recombination between two highly diverged parent strains

“…Primer walking was used to obtain the nucleotide sequence of approximately 7.5 kb of the 3′ end of the N1/08 genome, containing all of the structural protein genes. Alignments of available Australian IBV structural protein gene sequences (Mardani et al, 2006b) were used to design the primers that amplified fragments of the N1/ 08 cDNA. Each fragment was excised from an agarose gel, purified using a QIAquick Gel Extraction Spin Kit (Qiagen, Melbourne, Australia) and submitted for DNA sequencing (Applied Genetic Diagnostics, The University of Melbourne, Parkville, Australia).…”

Molecular typing of N gene and 3′ untranslated region of IBV field isolates and vaccine strains using RT-PCR and RFLP

“…Reverse transcription was carried out in a 25-μl reaction mixture according to a previous study (Mardani et al 2006b). For each cDNA synthesis, 5 μl of extracted RNA was denatured at 100°C for 1 min and immediately cooled down on ice for 5 min and then mixed with 20 μl of premix containing 24U RNAguard (Fermentas, Cinnagen, Iran), 0.5 μM oligo (dT) (Fermentas) 25 μM each of dATP, dTTP, dGTP and dCTP, 5 μl of 5X reaction buffer (Fermentas), 200 U Moloney murine leukaemia virus reverse transcriptase (Fermentas) and 10 μl diethyl pyrocarbonate-treated water.…”

“…The entire N gene and 3′ UTR of IBVs were amplified using two primers, 5b-F2 (5′ CCTTTTCGCGGAGCAATAG 3′), binding within 5b gene (nucleotides 25703 to 25721 H52 strain) which was designed in this study, and UTR-R1 (5′ CTGTACCCTCGATCGTACTC 3′) binding within 3′ UTR region from a previous study (Mardani et al 2006b). The PCR reaction was carried out in a 25-μl mixture, containing 25 μM each of dATP, dTTP, dGTP and dCTP, 0.25 μM each primer, 2.5 μl of 10X high-fidelity PCR buffer (Fermentas), 2 mM MgCl 2 , 1.0 U high-fidelity DNA polymerase (Fermentas) and 3 μl cDNA as template.…”

“…Due to the limitations of conventional methods in the identification of IBVs, reverse transcription and polymerase chain reaction (RT-PCR) accompanied with restriction fragment length polymorphism (RFLP) mainly based on S1 gene of IBVs has recently been employed for the rapid molecular identification of IBV isolates worldwide (Abreu et al 2006;Kwon et al 1993;Mardani et al 2006b;Wang and Khan 2000); however, because of the highly variable nature of the S1 gene of the IBV genome and occurring recombination events in this region, it can be difficult to find suitable primers for amplifying this gene for molecular analysis when a rapid response is required for an IBV outbreak (Jia et al 1995;Kottier et al 1995;Lee and Jackwood 2000). The 3′ UTR of the IBV genome has a highly variable region which has been used to differentiate different IBV strains in recent studies (Hewson et al 2009;Mardani et al 2006a;Williams et al 1993).…”