Typing of bovine attaching and effacing Escherichia coli by multiplex in vitro amplification of virulence-associated genes

China, Bernard; Pirson, Vinciane; Mainil, Jacques

doi:10.1128/aem.62.9.3462-3465.1996

Cited by 125 publications

(52 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Some E. coli isolates were also tested for the presence of the eaeA gene by PCR as described by China et al (1996). The reference strain E. coli RDEC-1 (O15:H-) was used as a positive control.…”

Section: Bacteriological Examinationsmentioning

confidence: 99%

“…perfringens and Cl. sordellii bacterial strains were plated onto Schaedler agar under anaerobic conditions and grown for 24-48 h. From these bacterial cultures, three suspensions composed of pooled bacterial strains China et al (1996) diluted with physiological salt solution were prepared. The first included approximately 10 7 colony forming unit (cfu) per millilitre of Cl.…”

Section: Experimental Reproduction Of Ere With Isolated Bacteriamentioning

confidence: 99%

See 1 more Smart Citation

Infectious agents associated with epizootic rabbit enteropathy: Isolation and attempts to reproduce the syndrome

Marlier

Dewrée

Lassence

et al. 2006

The Veterinary Journal

View full text Add to dashboard Cite

Epizootic rabbit enteropathy (ERE), a highly lethal (30-80% mortality) disease of broiler rabbits aged 6-14 weeks, first appeared in 1997 in French intensive enclosed rabbitries and is of unknown aetiology. Bacteriological, virological and parasitical examination of the intestinal contents of rabbits that had died either in spontaneous field cases or after experimental reproduction of ERE, were undertaken in an attempt to identify infectious agents that may play a role in the disease. Two bacterial strains, Clostridium perfringens and non-enteropathogenic Escherichia coli were repeatedly isolated at high faecal counts from naturally infected animals. In field cases, a correlation between typical gross lesions of epizootic enteropathy and the presence of the alpha toxin of Cl. perfringens was observed (P<0.0001; Chi-squared test). Although attempts to reproduce the disease by inoculation with different pools of cultivable bacterial strains failed, the disease was successfully reproduced by inoculation with one French and two Belgian samples of caecal contents.

show abstract

Section: Bacteriological Examinationsmentioning

confidence: 99%

Section: Experimental Reproduction Of Ere With Isolated Bacteriamentioning

confidence: 99%

Infectious agents associated with epizootic rabbit enteropathy: Isolation and attempts to reproduce the syndrome

Marlier

Dewrée

Lassence

et al. 2006

The Veterinary Journal

View full text Add to dashboard Cite

show abstract

“…The culture was incubated overnight at 378C under shaking. The PCR on eaeA gene was performed on the culture using the method previously described (China et al, 1996). The PCR on STIa (or STaP) gene was performed as described above using the following primers: B84 (TTTCTGTAT-TATCTTTCCCCTCTT) and B85 (AGCACAGGCAGGATTACAACAA).…”

Section: Polymerase Chain Reactionmentioning

confidence: 99%

“…The genetic diagnosis of AEEC can be performed either by hybridization using virulence gene-specific probes for eaeA, vt1 and vt2 genes (Mainil et al, 1993) or by specific amplification of virulence genes (China et al, 1996). We report here the detection of AEEC in calf populations in Belgium using these genetic tools.…”

Section: Introductionmentioning

confidence: 99%

Prevalence and molecular typing of attaching and effacing Escherichia coli among calf populations in Belgium

China

Pirson

Mainil

1998

Veterinary Microbiology

Self Cite

View full text Add to dashboard Cite

Attaching and effacing Escherichia coli are involved in diarrhea in 2 to 8-week old calves. The virulence factors of these bacteria include: (i) the secretion of proteins (i.e. EspB) involved in microvilli effacement, (ii) the production of the intimin, a 94 kDa outer membrane protein encoded by the eaeA gene and involved in the intimate attachment of bacteria to epithelial cell and (iii) the production of verotoxins: VT1 and/or VT2. We investigated the presence and the pathotype of these strains in several calf populations by colony hybridization or by genetic amplification. Using the colony hybridization method we showed first that only 5% of calves who died from diarrhea presented EaeA+ E. coli strains and secondly that 19% of healthy calves showed an asymptomatic carriage. However, using colony hybridization and genetic amplification, we identified EaeA+ strains in 91% of calves living in farms with recurrent diarrhea problems. In 66% of the calves, there was a correlation between the presence of AEEC and diarrhea. At the pathotype level, most of the EaeA+ isolates were negative for VT probes. In VT+ bacteria, the majority were VT1+. The number of VT positive bacteria was significantly higher in calves who died from diarrhea than in healthy or sick calves. This underlined the aggravating role of verotoxins in the disease. Moreover, only 25% of the bovine AEEC were positive with the EaeB probe. Surprisingly, the proportion of EaeB+ strains was significantly higher in healthy calves than in other populations.

show abstract

“…The probes were labelled with [α-32 P] dCTP by random priming using the dCTP-labelling beads (Ready to go, Pharmacia, Uppsala, Sweden). A PCR specific for the eae gene was performed on the faecal samples and on the internal organs with a positive culture, and a multiplex PCR for the intimin and verotoxin genes was performed on the faecal samples as described by China and collaborators [3]. PGFE was performed on a CHEF mapper apparatus (Bio-rad laboratories, Hercules, California, USA) using the following parameters: voltage of 6V/cm, migration time of 21 h, switch time of 2 to 20 s, angle of 120°, ramping factor of 1 379.…”

Section: Colony Hybridization Pcr and Pfgementioning

confidence: 99%

Clinical signs, reproduction of attaching/effacing lesions, and enterocyte invasion after oral inoculation of an O118 enterohaemorrhagic in neonatal calves

Stordeur

China

Charlier

et al. 2000

Microbes and Infection

View full text Add to dashboard Cite

Attaching and effacing (AE) lesions are produced among others by enteropathogenic Escherichia coli and enterohaemorrhagic E. coli (EHEC), which differs from the former by the production of cytotoxins active on various cell cultures, the verocytotoxins, or shigacytotoxins. EHEC are associated with diarrhoea and dysentery in humans and in ruminants, mainly calves from two to eight weeks of age. Clinical signs and/or lesions have been reproduced experimentally with EHEC strains belonging to serotypes O5:K4/Nm, O26:K-:H11, O111:Nm, and O157:H7 which are isolated from cattle and/or humans. The purpose of this work was to develop an experimental model of infection in newborn calves with a bovine EHEC strain isolated from a calf which of died of diarrhoea, and belonging to the O118:H16 serotype, which is also common to both cattle and humans. The bovine O118:H16 EHEC strain was able to colonize the gut of three newborn calves, and to induce diarrhoea twenty-four hours after challenge and to produce AE lesions in the small and/or large intestines. AE lesions were detected microscopically and ultrastructurally in the small intestine of one calf and in the whole intestinal track of two calves. Internalization of bacteria and also of pedestal-bacteria complex inside of the enterocyte was observed in two of the three calves. The significance of this stage is unknown but may be related to the invasion of the calf by the bacteria. The challenge strain was isolated from the mesenteric lymph nodes of the same two calves but not from other organs or from heart blood. No blood was observed in the faeces of any of the three calves, nor were any lesions in the internal organs, which may have been related to the production of a verotoxin whose role is still unknown in cattle.

show abstract

Typing of bovine attaching and effacing Escherichia coli by multiplex in vitro amplification of virulence-associated genes

Cited by 125 publications

References 21 publications

Infectious agents associated with epizootic rabbit enteropathy: Isolation and attempts to reproduce the syndrome

Infectious agents associated with epizootic rabbit enteropathy: Isolation and attempts to reproduce the syndrome

Prevalence and molecular typing of attaching and effacing Escherichia coli among calf populations in Belgium

Clinical signs, reproduction of attaching/effacing lesions, and enterocyte invasion after oral inoculation of an O118 enterohaemorrhagic in neonatal calves

Contact Info

Product

Resources

About