Tyrosine hydroxylase down-regulation after loss of Abelson helper integration site 1 (AHI1) promotes depression via the circadian clock pathway in mice

Abstract

(Haigang Ren) The abbreviations used were: 5-HT, serotonin; AHI1, Abelson helper integration site 1; BMAL1, brain and muscle arnt-like protein 1; CLOCK, locomotor output cycle kaput; DA, dopamine; KO, knockout; FST, forced swim test; MAOA, monoamine oxidase A; RORα, RAR-related orphan receptor alpha; NURR1, nuclear receptor-related protein 1; TH, tyrosine hydroxylase; TST, suspension test; VMB, ventral midbrain; VTA, ventral tegmental area. AbstractAbelson helper integration site 1 (AHI1) is associated with several neuropsychiatric and brain developmental disorders such as schizophrenia, depression, autism, and Joubert syndrome. Ahi1 deficiency in mice leads to behaviors typical of depression. However, the mechanisms by which AHI1 regulates behavior remain to be elucidated. Here, we found that down-regulation of expression of the rate-limiting enzyme in dopamine biosynthesis, tyrosine hydroxylase (TH), in the midbrains of Ahi1-knockout (KO) mice is responsible for Ahi1-deficiency-mediated depressive symptoms. We also found that Rev-Erbα, a TH transcriptional repressor and circadian regulator, is up-regulated in the Ahi1-KO mouse midbrains and Ahi1-knockdown Neuro-2a cells. Moreover, brain and muscle Arnt-like protein 1 (BMAL1), the Rev-Erbα transcriptional regulator, is also increased in the Ahi1-KO mouse midbrains and Ahi1-knockdown cells. Our results further revealed that AHI1 decreases BMAL1/Rev-Erbα expression by interacting with and repressing RAR-related orphan receptor alpha (RORα), a nuclear receptor and transcriptional regulator of circadian genes. Of note, Bmal1 deficiency reversed the reduction in TH expression induced by Ahi1 deficiency. Moreover, microinfusion of the Rev-Erbα inhibitor SR8278 into the ventral midbrain of Ahi1-KO mice significantly increased TH expression in the ventral tegmental area and improved their depressive symptoms. These findings provide a mechanistic explanation for a link between AHI1-related behaviors and the circadian clock pathway, indicating an involvement of circadian regulatory proteins in AHI1-regulated mood and behavior.

Serum Metabolic Profiling Reveals the Antidepressive Effects of the Total Iridoids of Valeriana jatamansi Jones on Chronic Unpredictable Mild Stress Mice

“…found that the levels of NE and 5-HT significantly decreased in mouse hippocampal tissues, which was consistent with the above result. TH, PAH, and TPH were found in Cytoscape to explore biomarker metabolism, and their enzyme expression was reduced in depression model rats or patients with depression (Guo et al, 2018;Scherer et al, 2018;Lu et al, 2019). This result may indicate that CUMS leads to a decrease in TH, PAH, and TPH activity and that the concentrations of synthetic catecholamine neurotransmitters, tyrosine, and phenylalanine are reduced, resulting in the symptoms of depression.…”

Pharmacological activation of REV-ERBα represses LPS-induced microglial activation through the NF-κB pathway

“…All animal protocols were approved by the Animal Committee of Soochow University. Mice were anesthetized and mounted in a stereotaxic apparatus (RWD Life Science Co, Shenzhen, China) that was described previously [11]. GSK4112 was dissolved in DMSO to a concentration of 40 μM and loaded into a 5-µL Hamilton syringe, which is fixed on stereotaxic apparatus.…”

DJ‐1 regulates tyrosine hydroxylase expression through CaMKKβ/CaMKIV/CREB1 pathway in vitro and in vivo

“…FLAG‐, enhanced green fluorescent protein (EGFP)‐, pDsRed‐, Myc‐ and His‐tagged DJ‐1 plasmids were previously described (Fan et al, ; Ren, Fu, Mu, Zhen, & Wang, ). PGL3‐ TH ‐luciferase plasmid was described previously (Guo et al, ). PGL3‐ TH ‐CRE (mutant) and ΔAP‐1 plasmids were obtained using wild‐type PGL3‐ TH ‐luciferase plasmid as a template by mutation polymerase chain reaction (PCR) through the primers 5′‐CGAGGCCTGGCCTTTAAG‐3′/5′‐AGACAAGCCCCTCTGGGT‐3′ and 5′‐GAGGCAGGTGCCTGCGACAGT‐3′/5′‐CCCTCCGCCCTAGACACGACA‐3′, respectively.…”