U87 RNA, a novel C/D box small nucleolar RNA from mammalian cells

Noncoding RNA of U87 host gene is associated with ribosomes and is relatively resistant to nonsense-mediated decay

“…Previously we have described a novel C/D box snoRNA U87 (Gogolevskaya et al, 2002). 1 Here we showed that U87 gene is located within an intron of a novel non-protein-coding gene, named U87HG (host gene).…”

“…Primer-extension was carried out as described previously (Gogolevskaya et al, 2002) with the following primers: #7 ACCACACCGGCATGACTAAC; #8 GCCCAAGGACAC-GCCGGGTTC, and #9 GCCGGAGGACACGCCGGGTTC complementary to exon 1 of human, mouse and rat U87HG gene, respectively.…”

“…The amplified PCR product was purified on a 4% NuSieve agarose gel and 0.5% of isolated DNA was reamplified in the reaction with the same primers and 25 μCi of α-[ 32 P] dATP. Probes for mouse and rat U87HG were prepared in the same way using previously cloned U87 gene locus (Gogolevskaya et al, 2002). The following primers were used: primers #3 and 5′ GGCAAATGTAGTCCTGGC specific for the second exon of mouse U87HG; primers 5′ ATGTA-GGTAGCTGCAGT and #6 for rat third U87HG exon.…”

“…The following primers were used: primers #3 and 5′ GGCAAATGTAGTCCTGGC specific for the second exon of mouse U87HG; primers 5′ ATGTA-GGTAGCTGCAGT and #6 for rat third U87HG exon. A probe for the U87 snoRNA was synthesized as described previously (Gogolevskaya et al, 2002).…”

Identification of a novel box C/D snoRNA from mouse nucleolar cDNA library

“…On the other hand, although mammalian intronic snoRNAs have shown to be multitudinous, identities of many host genes of snoRNAs in mammals remain to be elucidated. Thus, efforts to identify new mammal snoRNA gene and their targets in rRNAs or other cellular RNAs continue (Gogolevskaya et al, 2002;Darzacq et al, 2002). In the present study, we report the identification of a novel mammalian snoRNA from a mouse liver cDNA library.…”