Ubiquitin ligase TRAIP plays an essential role during the S-phase of unperturbed cell cycle in the resolution of DNA replication – transcription conflicts

Abstract

Cell division is the basis for the propagation of life and requires accurate duplication of all genetic information. DNA damage created during replication (replication stress) is a major cause of cancer, premature aging and a spectrum of other human disorders. Over the years, TRAIP E3 ubiquitin ligase has been shown to play a role in various cellular processes that govern genome integrity and faultless segregation. TRAIP is essential for cell viability, and mutations in TRAIP ubiquitin ligase activity lead to primordial dwarfism in patients. Here, for the first time, we have determined the mechanism of inhibition of cell proliferation in TRAIP-depleted cells. We have taken advantage of the auxin induced degron system to rapidly degrade TRAIP within cells and to dissect the importance of various functions of TRAIP in different stages of the cell cycle. We find that upon rapid TRAIP degradation, specifically in S-phase, cells cease to proliferate, arrest in G2 stage of the cell cycle and undergo senescence. Our findings reveal that TRAIP works in S-phase to prevent DNA damage at transcription start sites, caused by replication-transcription conflicts.

Characterizing replisome disassembly in human cells

“…HCT116 Tet-OsTIR1 LRR1-mAC degron cells were generated as detailed in 50 and grown in conditions detailed above. Bi-allelic gene tagging was confirmed using genomic PCR, see.…”

“…Bi-allelic gene tagging was confirmed using genomic PCR, see. 50 Genomic PCR was carried out using GoTaq HotStart Green MasterMix (Promega), as per manufacturer’s instruction, using the following primers: mAID Forward Primer ATCTTTAGGACAAGCACTCTTCTCC (5′-3′), LRR1 Forward: AGGAATTGCCAAGTCAAATACAG (5′-3′), LRR1 Reverse: AGGGAGAATATTGTGGGAGAAAG (5′-3′).…”

Characterising replisome disassembly in human cells

“…HCT116 cell lines (ATCC) were grown in McCoys 5A media + 10% FBS (Tet-free for DOX-inducible lines) + 1% pen/strep + 2 mM L-Glutamine. HCT116 conditional degron cells were generated as detailed in (47). Bi-allelic gene tagging was confirmed using genomic PCR, see (47), using the following primers: mAID Primer ATCTTTAGGACAAGCACTCTTCTCC, LRR1 Forward: AGGAATTGCCAAGTCAAATACAG, LRR1 Reverse: AGGGAGAATATTGTGGGAGAAAG.…”

“…HCT116 conditional degron cells were generated as detailed in (47). Bi-allelic gene tagging was confirmed using genomic PCR, see (47), using the following primers: mAID Primer ATCTTTAGGACAAGCACTCTTCTCC, LRR1 Forward: AGGAATTGCCAAGTCAAATACAG, LRR1 Reverse: AGGGAGAATATTGTGGGAGAAAG. U2OS FLAG-MCM7 and FLAG-MCM4 cells were generated using the U2OS Flp-In cell line, as previously described (48).…”