Udenafil, a Phosphodiesterase 5 Inhibitor, Reduces Body Weight in High-Fat-Fed Mice

Abstract

PurposeHigh-fat (HF) feeding induces hypothalamic leptin resistance via the activation of toll-like receptor 4 (TLR4). TLR4 deficiency confers resistance to diet-induced obesity. Udenafil, an anti-impotence drug, inhibits TLR4 in airway epithelial cells in vitro. In this study, we evaluated whether udenafil suppressed the hypothalamic expression of TLR4 and reduced body weight.Materials and MethodsThe hypothalamic expression of TLR4, phosphodiesterase 5 (PDE5), nuclear factor-κB (NF-κB), and myeloid differentiation primary response gene 88 (Myd88) was analyzed by real-time polymerase chain reaction after treating mice for 2 days with udenafil (0, 12, 120, or 600 µg/d). Furthermore, the hypothalamic expression of TLR4, pro-opiomelanocortin (POMC), and neuropeptide Y (NPY) was analyzed after 9 days' treatment with udenafil and/or leptin. We also measured body weight and food intake following 9 days of udenafil and/or leptin treatment in control- and HF-fed mice.ResultsUdenafil suppressed hypothalamic TLR4 mRNA expression dose-dependently. The changes were associated with decreased PDE5, NF-κB, and Myd88 expression. Udenafil treatment for 9 days reduced body weight and caloric intake in HF-fed mice. This may have been associated with the suppression of NPY expression that was elevated by HF feeding. POMC expression was not affected by udenafil. However, udenafil did not augment the effects of leptin on the reduction of body weight and caloric intake in HF-fed mice.ConclusionsThese results suggested that udenafil reduced body weight by suppressing hypothalamic TLR4 mRNA expression in HF-fed mice and the combination effect of udenafil and leptin was additive rather than synergistic.

Advantages of Phosphodiesterase Type 5 Inhibitors in the Management of Glucose Metabolism Disorders: A Clinical and Translational Issue

“…It is characterized by high blood sugar and insulin resistance [64]. In this population, PDE5i (particularly tadalafil and sildenafil) have been proven not only to be safe in diabetic men experiencing ED [59,65,66] but also to directly control metabolism regulation as T2DM tends to ameliorate after specific PDE5 inhibition (Figure 2) [20,22]. Several studies have focused on the use of the PDE5i to treat inflammation, vascular injury, and hepatic diseases often associated with diabetes in both animal models and humans [67][68][69].…”

“…Different studies performed in diet-induced obese animal models have investigated the effects of a new PDE5i, DA-8159, as well as the PDE5i udenafil. In these studies, the authors demonstrated that the oral administration of PDE5i ameliorated body weight, plasma cholesterol and triglyceride levels, visceral fat mass, cumulative caloric intake, and plasma leptin concentration in comparison with vehicle-treated mice [ 58 , 59 ].…”

“…It is characterized by high blood sugar and insulin resistance [ 64 ]. In this population, PDE5i (particularly tadalafil and sildenafil) have been proven not only to be safe in diabetic men experiencing ED [ 59 , 65 , 66 ] but also to directly control metabolism regulation as T2DM tends to ameliorate after specific PDE5 inhibition ( Figure 2 ) [ 20 , 22 ].…”

Male health and obesity – diagnostic and therapeutic approach

“…Активно обсуждается роль системного воспаления в патогенезе ЭД, ассоциированной с ожирением. Свободные жирные кислоты активируют Toll-подобные рецепторы, запуская внутриклеточный сигнальный каскад с участием большого количества разнообразных провоспалительных цитокинов [5]. Провоспалительные цитокины, в свою очередь, подавляют каскад эндотелиальной NO-синтазы и провоцируют тем самым эндотелиальную дисфункцию [6].…”

The Analysis of Primer Gene of Phosphodiesterase Type 5 (PDE5) on Erectyle Dysfungction

“…GCTTGGTCTTGAATGAAGTCA, successfully demonstrated that udenafil suppresses TLR4 mRNA expression in the hypothalamus [9]. Another study conducted by Fiore et al (2018) with sequence forward: GGAGGAGAATACTGGCAAGA, reverse: GATGCATGGTAAGACAGGAC; in type 2 diabetic mice administrated sildenafil for 12 weeks could increase adipogenesis and improve adipose tissue [10].…”