Ultrastructure and Activity of Some Enzymes of Energy Metabolism of Skeletal Muscle in Experimental Energy Deficiency

Mehta, J.; Js, Chopra; Mehta, S.; Nain, C. K.; Bhagwat, A G; Dhand, Ushak K.; Rana, Satyavati

doi:10.1159/000177246

Cited by 7 publications

(3 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Animais jovens sub-metidos à desnutrição e à posterior recuperação nutricional mantêm o agravo prévio de ultra-estrutrura de mitocôndrias 44 e mantêm a limitação da refosforilação do ADP 45 . Esses fatos indicam persistência da disfunção mitocondrial, apesar da recuperação nutricional.…”

Section: Discussionunclassified

Intrauterine energetic malnutrition in rats: skeletal muscle changes in the 1st and 2nd generations

Fl¹,

As²,

Schmidt³

et al. 1999

J Pediatr (Rio J)

View full text Add to dashboard Cite

ResumoObjetivo: Estudar o músculo esquelético (ME) de recém-nascidos desnutridos intra-uterinos através de biopsia muscular com estudo histoquímico.Material e Métodos: Utilizaram-se ratas Wistar EPM-1, 90 dias, peso 200 ± 20g, desnutridas durante toda gestação. No 21 o dia de gestação foi colhida biopsia do músculo biceps braquii dos recém-nascidos (RN), obtidos por cesária (1 a geração). Um grupo de RN desnutridos foi recuperado nutricionalmente após o nascimento, pela permanência de seis filhotes/rata nutriz e pela alimentação ad libitum até o 90 0 dia de vida, quando as fêmeas foram colocadas para cruzamento, originando os recém-nascidos da 2ª geração.Resultados: O ganho de peso durante a gestação e o peso do RN foram significativamente diferentes quando comparado cada grupo desnutrido ao seu respectivo grupo controle. As biopsias musculares dos RN desnutridos intra-uterinos apresentaram comprometimento como perda do predomínio de fibra tipo II, diminuição do diâmetro das fibras musculares, baixa atividade oxidativa, proliferação de tecido intersticial e edema. Na segunda geração, os recém-nascidos apresentaram peso corporal adequado, mas mantinham o comprometimento do tecido muscular como diminuição do predomínio de fibras tipo II, diminuição do diâmetro das fibras musculares, baixa atividade oxidativa, presença de aumento de espaço intersticial, aumento de necrose mas sem edema.Conclusão: A desnutrição energética na fase intra-uterina afeta diretamente o ME, podendo causar alterações irreversíveis que se repetem na geração seguinte, indicando a gravidade de a desnutrição ocorrer na fase crítica de desenvolvimento do tecido muscular. AbstractObjective: To study by histochemical analysis the skeletal muscle in malnourished newborn rats submitted to intrauterine malnutrition.Methods: 90 days old female, Wistar EPM-1 rats, with 200 ± 20g body weight, malnourished during the gestation period were studied. At the 21 th day of gestation, muscular biopsy was performed in the biceps bracchi of the newborns, obtained by cesarean (1 st generation). One group of newborn intrauterine malnourished rats had nutritional recovery after birth by staying six/lactating rat and by free feeding up to the 90 th day of life, when the females became pregnant and their offspring formed the 2 nd generation.Results: Weight gain during gestation and body weight of the newborn were significantly different when each malnourished group was compared to its respective control. The muscular biopsies of the malnourished newborns presented tissue involvement, characterized by loss of predominance of type II fibres, low oxidative activity, lessening of muscular fiber diameter, proliferation of intersticial tissue, and edema. In the 2 nd generation, the newborns presented adequate body weight, but maintained muscular tissue involvement, with lessening of predominance of type II fibers, reduction of muscular fiber diameter, low oxidative activity, increase of intersticial space, necrosis, but without edema.Conclusion: The energetic malnutrition ...

show abstract

Section: Discussionunclassified

Intrauterine energetic malnutrition in rats: skeletal muscle changes in the 1st and 2nd generations

Fl¹,

As²,

Schmidt³

et al. 1999

J Pediatr (Rio J)

View full text Add to dashboard Cite

show abstract

“…Allele-specific PCR-based M-PFK Test-Genomic DNA was harvested from 100 l of EDTA-anticoagulated blood as described (17). Amplification of 5-10% of this DNA was performed using primers with the sequence ctggggatgcgtaagagggctctgg (PFKexon21) and gaggatgggcctcagcttcaggcac (PFKBan) which correspond to bases 2137-2161 of the coding sequence and bases 2229 -2253 of the non-coding strand, respectively.…”

Section: Methodsmentioning

confidence: 99%

Molecular Basis of Canine Muscle Type Phosphofructokinase Deficiency

Smith

Stedman

Rajpurohit

et al. 1996

Journal of Biological Chemistry

View full text Add to dashboard Cite

Muscle type phosphofructokinase (M-PFK) deficiency is a rare inherited glycogen storage disease in humans that causes exertional myopathy and hemolysis. The molecular basis of canine M-PFK deficiency, the only naturally occurring animal homologue, was investigated. Lack of M-PFK enzyme activity was caused by a nonsense mutation in the penultimate exon of the M-PFK gene, leading to rapid degradation of a truncated (40 amino acids) and therefore unstable M-PFK protein. A polymerase chain reaction-based test was devised to identify M-PFK-deficient and carrier animals. This represents one of only a few inborn errors of metabolism where the molecular defect has been identified in a large animal model which can now be used to develop and assess novel therapeutic strategies.

show abstract

“…As discussed earlier, under nutrient deprivation, TAC flux and consequently mitochondrial metabolism are altered. Mehta et al (165) demonstrated reduced oxidative enzyme activities in growing young monkeys submitted to a low energy intake, being associated with peripheral insulin resistance and type 2 diabetes. However, as proposed for ordinary nutrition conditions, TAC flux might be reduced by impaired specific TAC enzyme activities or anaplerosis capacity, and so further studies are needed to answer the remaining questions.…”

Section: Protein Malnutrition and Peripheral Insulin Resistancementioning

confidence: 99%

Insulin release, peripheral insulin resistance and muscle function in protein malnutrition: a role of tricarboxylic acid cycle anaplerosis

et al. 2009

View full text Add to dashboard Cite

Pancreatic beta-cells and skeletal muscle act in a synergic way in the control of systemic glucose homeostasis. Several pyruvate-dependent and -independent shuttles enhance tricarboxylic acid cycle intermediate (TACI) anaplerosis and increase beta-cell ATP:ADP ratio, triggering insulin exocytotic mechanisms. In addition, mitochondrial TACI cataplerosis gives rise to the so-called metabolic coupling factors, which are also related to insulin release. Peripheral insulin resistance seems to be related to skeletal muscle fatty acid (FA) accumulation and oxidation imbalance. In this sense, exercise has been shown to enhance skeletal muscle TACI anaplerosis, increasing FA oxidation and by this manner restores insulin sensitivity. Protein malnutrition reduces beta-cell insulin synthesis, release and peripheral sensitivity. Despite little available data concerning mitochondrial metabolism under protein malnutrition, evidence points towards reduced beta-cell and skeletal muscle mitochondrial capacity. The observed decrease in insulin synthesis and release may reflect reduced anaplerotic and cataplerotic capacity. Furthermore, insulin release is tightly coupled to ATP:ADP rise which in turn is related to TACI anaplerosis. The effect of protein malnutrition upon peripheral insulin resistance is time-dependent and directly related to FA oxidation capacity. In contrast to beta-cells, TACI anaplerosis and cataplerosis pathways in skeletal muscle seem to control FA oxidation and regulate insulin resistance.

show abstract

Ultrastructure and Activity of Some Enzymes of Energy Metabolism of Skeletal Muscle in Experimental Energy Deficiency

Cited by 7 publications

References 30 publications

Intrauterine energetic malnutrition in rats: skeletal muscle changes in the 1st and 2nd generations

Intrauterine energetic malnutrition in rats: skeletal muscle changes in the 1st and 2nd generations

Molecular Basis of Canine Muscle Type Phosphofructokinase Deficiency

Insulin release, peripheral insulin resistance and muscle function in protein malnutrition: a role of tricarboxylic acid cycle anaplerosis

Contact Info

Product

Resources

About