Understanding subterranean variability: the first genus of Bathynellidae (Bathynellacea, Crustacea) from Western Australia described through a morphological and multigene approach

Abstract

The number of subterranean taxa discovered in the north of Western Australia has substantially increased due to the requirements for environmental surveys related to mining development. Challenges in estimating subterranean biodiversity and distributions are related to lack of knowledge of taxa with convergent morphological characters in a largely unobservable ecosystem setting. An integrated approach is warranted to understand such complexity. Bathynellidae occur in most Australian aquifers, but only one species has been described so far, and the group lacks a reliable taxonomic framework. A new genus and one new species from the Pilbara region of Western Australia, Pilbaranella ethelensis, gen. et sp. nov., is described using both morphological and molecular data. Three additional species of Pilbaranella are defined through mitochondrial and nuclear genes, using Automatic Barcode Gap Discovery and Poisson Tree Processes species delimitation methods. A comparison of morphology and 18S rRNA sequences between Pilbaranella, gen. nov. and known lineages provides the evidentiary basis for the decision to establish a new genus. This study provides a morphological and molecular framework to work with Bathynellidae, especially in Australia where a highly diverse fauna remains still undescribed.

The role of allopatric speciation and ancient origins of Bathynellidae (Crustacea) in the Pilbara (Western Australia): two new genera from the De Grey River catchment

“…The bathynellids collected in the Goldsworthy area during surveys between 2007 and 2009 by Subterranean Ecology is the source of the material used for this study. Stygofauna was sampled according to the EPA guidelines (Environmental Protection Authority, 2003, 2007, while specimen preservation follows Perina et al (2018). (Simon et al, 1994) 21 C1-J-2329 R 5' ACTGTAAATATATGATGAGCTCA 3' 16S 16SSarL F 5' CGCCTGTTTAACAAAAACAT 3' (Palumbi et al, 1991) 3 16S SbrH R 5' CCGGTCTGAACTCAGATCACGT 3' 16SBathy-21F 5' ARTAHAATCTGCCCGGTGAT 3' Whiting et al, 1997) 37 16SBathy-53F 5' ACGGCCGCAGTAWTTTGACT 3' (Perina et al, 2019) 5 16S 16SBathy-453R 5' TCCAACATCGAGGTCGHAAAC 3' 42 18Si 1F 5' TACCTGGTTGATCCTGCCAGTAG 3' (Giribet et al, 1996) 43 5R 5' CTTGGCAAATGCTTTCGC 3' 18Sii 3F 5' GTTCGATTCCGGAGAGGGA 3' (Giribet et al, 1996) 43 18Sbi 5' GAGTCTCGTTCGTTATCGGA 3' (Whiting et al, 1997) 18Siii 18Sa2.0 5' ATGGTTGCAAAGCTGAAAC 3' (Whiting et al, 1997) 37 9R 5' GATCCTTCCGCAGGTTCACCTAC 3' (Giribet et al, 1996) 28S 28S-D1F 5' GGGACTACCCCCTGAATTTAAGCAT 3' (Park et al, 2000) 56 28Sb 5' TCGGAAGGAACCAGCTACTA 3' (Nunn et al, 1996) ITS2 5.8S2 5' GGGTCGATGAAGAACGCAGC 3' (Rix, 2009)…”

“…Tissue sampling, DNA extraction, PCR amplification, and DNA sequencing follow the procedures described in Perina et al (2018). The mitochondrial Cytochrome oxidase I (COI), and 16S ribosomal RNA (16S), and the nuclear 28S, 18S ribosomal RNA, and the Internal Transcribed Spacer 2 (ITS2) markers were amplified using the primers listed in table 1.…”

“…The morphological study follows the methods described in Perina & Camacho (2016) and Perina et al (2018). The material is vouchered at the Western Australian Museum (see Appendix 2 for voucher numbers).…”

Application of propylene glycol in DNA-based studies of invertebrates

“…More so, PG can be even added to ethanol-preserved specimens to retain flexibility and to reduce shrinkage effects without compromising DNA integrity and storage conditions (Boaze and Waller 1992;Carter 2003), e.g. for improving morphological determinability and dissection conditions (Karanovic et al 2012(Karanovic et al , 2016Martin 2016;Perina et al 2018;Herrera Russert 2019). This 'relaxation' property of PG was exploited by several studies examining DNA markers and morphology of the very same specimens (Villacorta et al 2008;Krosch et al 2013;Boontop et al 2017b;Gregoire Taillefer and Wheeler 2018;Grando et al 2018).…”

Hábitat inusual para Bathynellacea (Crustacea, Malacostraca): primer registro de este crustáceo de agua subterránea en el sustrato superficial mesovoide (MSS)

“…This discovery broadens the sampling horizon for this peculiar group of aquatic crustaceans. It will be necessary to consider looking for Bathynellacea in areas where there are shallow aquifers, more or less confined, and not as deep as those that have yielded such a large number of species as in the mining arid and remote areas of Australia (Perina et al, 2018(Perina et al, , 2019.…”