Universal Amplification and Analysis of Pathogen 16S rDNA for Classification and Identification of Mycoplasmalike Organisms

Lee, I.-M; Hammond, Rosemarie W.; Davis, Robert E.; Gundersen, D. E.

doi:10.1094/phyto-83-834

Cited by 638 publications

(478 citation statements)

References 0 publications

Supporting

Mentioning

425

Contrasting

Unclassified

Order By: Relevance

“…Porém, quando estas mesmas amostras foram submetidas a PCR para detecção de fitoplasma, utilizando-se os primers universais R16F2 e R16R0 (Lee et al, 1993), duas amostras apresentaram resultado positivo. Esse resultado sugere tratar-se de um fitoplasma distinto de "Maize bushy stunt phytoplasma", havendo necessidade de mais estudos para confirmação e caracterização do possível agente etiológico distinto.…”

Section: Resultsunclassified

“…Nas seis amostras com sintomas atípicos de MBSP, a detecção de fitoplasma foi testada também utilizando-se condições de reação e os oligonucleotídeos R16F2 5' ACGACTGCTGCTAAGACTGG 3'e R16R0 5' TGA CGGGCGGTGTGTACAAACCCCG 3', descritos por Lee et al (1993). A detecção de espiroplasma foi feita utilizando-se condições de reação e oligonucleotídeos CSSF2 5' GGCAAAAGATGTAACAAAAGT 3' e CSSR6 5' GTTTACTTCAACAGTAGTTGCG 3', segundo Barros et al (2001).…”

Section: Methodsunclassified

See 1 more Smart Citation

Incidência de viroses e enfezamentos e estimativa de perdas causadas por molicutes em milho no Paraná

Oliveira

Resende

Pecci

et al. 2003

Pesq. agropec. bras.

View full text Add to dashboard Cite

Resumo -O objetivo deste trabalho foi avaliar a incidência de viroses e enfezamentos e estimar as perdas causadas por enfezamentos na cultura do milho safrinha. Os diagnósticos baseados em sintomas foram confirmados por PCR ou RT-PCR. Em todas as lavouras, foram identificadas plantas com sintomas de enfezamentos, em incidência de 6,2% a 49,9% (média de 20,7%). Na identificação de insetos vetores desses patógenos, a cigarrinha Dalbulus maidis foi detectada em 20 lavouras das 24 amostradas, constituindo 66,6% do total de espécimens de cigarrinhas coletadas. A perda potencial causada pelos enfezamentos no período foi estimada em cerca de 16,5 milhões de dólares. A ocorrência de plantas com sintomas de "Maize rayado fino virus" e "Maize dwarf mosaic virus" foi baixa e o diagnóstico confirmado por RT-PCR. A análise de 441 amostras suspeitas de infecção por "Mal de Río Cuarto virus", por DAS-ELISA, mostrou ausência desse vírus. Resultados de PCR indicaram a presença de um possível fitoplasma distinto de "Maize bushy stunt phytoplasma" em duas plantas apresentando nanismo acentuado, folhas estreitas, enrijecidas, com deformações, e grãos na inflorescência, havendo necessidade de mais estudos para a confirmação da identidade desse possível novo fitoplasma.Termos para indexação: Zea mays, espiroplasma, doença das plantas. Occurrence of viruses and stunting diseases and estimative of yield losses by mollicutes in corn in Paraná State, BrazilAbstract -The objective of this work was to evaluate the occurence and yield losses by corn stunting diseases and maize viruses in "safrinha" season. Disease diagnostics based on plant symptoms were confirmed by PCR or RT-PCR assays. Insect samples were collected in 24 fields for identification of vectors of the pathogens. Corn stunting diseases symptoms were observed in all crops evaluated, with incidence levels ranging from 6.2% to 49.9% (average 20.7%) and the presence of the leafhopper Dalbulus maidis, was detected in 20 of the 24 areas evaluated. This insect species was prevalent, representing 66,6% of total leafhoppers specimens collected.

show abstract

Section: Resultsunclassified

Section: Methodsunclassified

Incidência de viroses e enfezamentos e estimativa de perdas causadas por molicutes em milho no Paraná

Oliveira

Resende

Pecci

et al. 2003

Pesq. agropec. bras.

View full text Add to dashboard Cite

show abstract

“…Phylogenetic analyses of phytoplasmal 16s rRNA and ribosomal protein genes have revealed that these organisms constitute a genuslevel taxon (Gundersen et al, 1994, Seemuller et at., 1994. Approximately 15 groups (putative species) of phytoplasmas and several sub-groups have been delineated on the basis of differences in 16s rDNA sequences (Gundersen et al, 1994;Lee et al, 1993b;Namba et al, 1993;Schneider et al, 1995b;Seemuller et al, 1994). This delineation is supported by sequence differences in ribosomal protein genes (Gundersen et al, 1994;Lee et al, 1998) and the gene encoding elongation factor Tu (Schneider et al, 1997).…”

Section: Introductionmentioning

confidence: 99%

The phytoplasma associated with ash yellows and lilac witches'-broom: ‘Candidatus Phytoplasma fraxini’

Griffiths

Sinclair

Smart

et al. 1999

International Journal of Systematic and Evolutionary Microbiology

110

View full text Add to dashboard Cite

Phytoplasmas associated with the plant diseases ash yellows (Ashy, occurring in fraxinus) and lilac witches'-broom (LWB, occurring in Syringa) represent a putative species-level taxon. Phytoplasmal DNA from 19 ash or lilac sources across the known geographic range of Ashy (71-113 OW) was examined to determine if Ashy and LWB phytoplasmas are a coherent group, if variability exists in both conserved and anonymous DNA, and if variability in 16s rDNA is related to host or geographic origin. The 165 rRNA gene and the 16S-235 spacer were amplified using primer pair PWP7 and analysed using 15 restriction enzymes. RFLPs were detected in digests obtained with A M , Hhal or Taql, for a total of four RFLP profile types. Sequencing of the amplimers from strains AshYIT, AshY3, Ashy5 and LWB3 (which represent the four 16s rDNA RFLP profile types) revealed only three positions in the 16s rRNA gene and one position in the 16S-23s spacer a t which differences occurred; these were single nucleotide substitutions. Sequence homology between any two strains was >99-8%. A portion of a ribosomal protein operon, amplified with primer pair rpFI/Rl from each of the four strains noted above, was analysed with six restriction enzymes, resulting in the detection of two RFLP profiles with MseI. Southern analysis, utilizing two non-specif ic probes from other phytoplasma groups, revealed three RFLP profile types in anonymous chromosomal DNA of strains representing the four 16s rDNA genotypes. Two strains, Ashy3 and LWB3, had unique combinations of characters in the various assays. On the basis of RFLP profiles, the strains from the other plants sampled comprised two groups. The grouping was not clearly related to host or geographic origin. The genome size of strain Ashy3 was estimated from PFGE data to be 645 kbp. Phylogenetic analysis of a 1423 bp 165 rDNA sequence from strains AshYIT, AshY3, Ashy5 and LWB3, together with sequences from 14 other mollicutes archived in GenBank, produced a tree on which the Ashy and LWB strains clustered as a discrete group, consistent with previous analyses utilizing only type strain AshYIT. Thus, the Ashy phytoplasma group is coherent but heterogeneous. The name 'Candidatus Phytoplasma fraxini ' is proposed for this group.

show abstract

“…To date, the most reliable classifications of phytoplasmas have been based on DNA restriction analysis and phylogenetic sequence analysis, usually of the PCR-amplified 16s rRNA gene plus 16s-23s rRNA intergenic spacer region (R. E. ; R. I. Gundersen et al, 1994Gundersen et al, , 1996Lee et al, 1993;Namba et al, 1993;Schneider et al, 1993Schneider et al, , 1995aSeemuller et al, 1994). These analyses have allowed the provisional classification of phytoplasmas from Europe, North America, Asia and Australia.…”

Section: Introductionmentioning

confidence: 99%

Phylogenetic positions of phytoplasmas associated with dieback, yellow crinkle and mosaic diseases of papaya, and their proposed inclusion in ' Candidatus Phytoplasma australiense' and a new taxon, 'Candidatus Phytoplasma australasia'

White

Blackall

Scott

et al. 1998

International Journal of Systematic Bacteriology

117

View full text Add to dashboard Cite

DNA extracted from three papaya (Carica papaya L.) plants, individually affected by dieback, yellow crinkle or mosaic diseases, was subjected to PCR using phytoplasma-specific primers to amplify the 165 rRNA gene plus 165-235 rRNA intergenic spacer region. Near-complete DNA sequences obtained for the three PCR amplimers were subjected to phylogenetic analyses and direct sequence comparison with other phytoplasma 165 rDNA and 165-235 spacer region DNA sequences. The papaya yellow crinkle (PpYC) and papaya mosaic (PpM) sequences were identical to each other, but distinctly different from the papaya dieback (PpDB) sequence, showing 9003% identity in the 165 rDNA and 8708% identity in the 165-235 spacer region DNA sequences. A phylogenetic tree based on 165 rDNA sequences was calculated, in which PpYC and PpM are most closely related to the tomato big bud phytoplasma (TBB; 99.7% 165 rDNA sequence identity) from Australia, within subclade iii. This subclade consists of strains only reported occurring in the Southern Asian region and Australia, which indicates an Asian/Australasian origin. PpDB is most closely related to the Phormium yellow leaf phytoplasma from New Zealand (PYL; 99.9% identity) and the Australian grapevine yellows phytoplasma (AGY; 99.7 YO identity). These three phytoplasma strains form a distinct clade within subclade xii, which also includes the European strains STOL and VK as another distinct clade. The origin of the closely related but geographically separated AGY-like strains and STOL-like strains of subclade xii is unclear. It is proposed that phytoplasma strains PpDB, PYL and AGY be included in the previously described taxon Candidatus Phytoplasma australiense ' 8 and that PpYc, PpM and TBB be assigned to a new taxon, Candidatus Phytoplasma australasia I .

show abstract

Universal Amplification and Analysis of Pathogen 16S rDNA for Classification and Identification of Mycoplasmalike Organisms

Cited by 638 publications

References 0 publications

Incidência de viroses e enfezamentos e estimativa de perdas causadas por molicutes em milho no Paraná

Incidência de viroses e enfezamentos e estimativa de perdas causadas por molicutes em milho no Paraná

The phytoplasma associated with ash yellows and lilac witches'-broom: ‘Candidatus Phytoplasma fraxini’

Phylogenetic positions of phytoplasmas associated with dieback, yellow crinkle and mosaic diseases of papaya, and their proposed inclusion in ' Candidatus Phytoplasma australiense' and a new taxon, 'Candidatus Phytoplasma australasia'

Contact Info

Product

Resources

About