Universal Primers for Amplification of TNF-α -308 Promoter Region

Pollo, Gracia Alice Victoria; Sumarauw, Sarah Celia Pertiwi; Hessel, Sofia Safitri; Tallei, Trina Ekawati

doi:10.3923/pjbs.2019.585.589

Cited by 2 publications

(2 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1) DNA Sequencing TNF-α Promoter (-238 G/A, and -308 G/A, -376 G/A) SNPs were amplified using following primers: forward primer 5'-AACCAGCATTATGAGTCTC-'3 and revers primer 5'AACAACTGCCTTTATATGTC'3 [19] that give product of 677bp in size , and TNFRII exon 6 (+587 T/G) SNP was amplified using following primers: forward primer 5'-ACTCTCCTATCCTGCCTGCT-'3 and revers primer 5'-TTCTGGAGTTGGCTGCGTGT-'3 [20] that give product of 242bp in size, then genotyped by sequencing. TNF-α gene amplification and identification were carried out using the previously mentioned PCR protocol.…”

Section: H Genotypingmentioning

confidence: 99%

Biogenetic Markers for Predicting Response to Immunotherapy in Rheumatoid Arthritis

Jabbar

Mohammed²,

Ali³

2023

EJBIOMED

View full text Add to dashboard Cite

Background: TNF-α plays a critical role in the pathogenesis of RA. Gene polymorphisms occurring in this pro-inflammatory cytokine or their receptors may influence responses to biological therapy. Objectives: This study aimed to evaluate the impact of -238G/A(rs361525), -308G/A(rs1800629), -376G/A(rs1800750), +489G/A(rs80267059) SNPs in TNF-α and +587T/G(rs1061622), +884A/G(rs5746032) SNPs in TNFRII genes on responsiveness to TNF inhibitors as well as their effect on serum levels of TNF-α and TNFRII. Subjects and methods: Sixty patients with RA treated with anti-TNF therapy (30 responders and 30 non-responders) were allocated to this study. SNPs in the TNF-α and TNFRII genes were studied by three different techniques: PCR-sequencing, PCR-RFLP, and q-PCR-TaqMan assay. TNF-α and TNFRII serum levels were determined using the ELISA technique. Results: TNF-α -308 (GA), +489 (GA), and TNFRII +587 (TG) genotypes were found to be more associated with non-responsiveness to TNF than homozygous genotypes (OR: 1.3, 2.5, and 2.0, respectively). On other hand, TNF-α -238 and -376 (GA) genotypes, were found to be more associated with TNFi responsiveness than homozygous genotypes (OR: 0.172 and 0.22, respectively). However, none of them reached a significant level. Furthermore, the studied SNPs were found to be unrelated to serum levels of TNF-α and TNFRII. Conclusion: According to our findings, the TNF-α -238G/A, -308G/A, -376G/A, +489G/A, and TNFRII +587T/G, +884A/G SNPs were not significantly associated with the responsiveness of RA patients to biological therapy and had no effect on the serum levels of TNF-α and TNFR.

show abstract

Section: H Genotypingmentioning

confidence: 99%

Biogenetic Markers for Predicting Response to Immunotherapy in Rheumatoid Arthritis

Jabbar

Mohammed²,

Ali³

2023

EJBIOMED

View full text Add to dashboard Cite

show abstract

“…The forward primer 5'-AACCAGCATTATGAGTCTC-'3 and revers primer 5'AACAACTGCCTTTATATGTC'3 (Pollo et al, 2019) were used to amplify a 677-bp product in TNF-α promotor region by thermocycler (Applied Biosystem, US). The PCR component consists of2 µl of DNA, 1 µl per primer, 12.5 µl master mix, and 8.5 µl of nuclease-free water.…”

Section: Molecular Study (Pcr Amplification and Sequence Analysis)mentioning

confidence: 99%

Association of genetic variation in tumor necrosis factor-α gene with susceptibility to rheumatoid arthritis in southern Iraq

Jabbar¹

2023

UTJsci

View full text Add to dashboard Cite

Background: Rheumatoid arthritis is the most commonly occurring systemic autoimmune disease caused by genetic, epigenetic, and environmental factors. It affects 0.5-1% of the worldwide population and increases in incidence with age. Tumor necrosis factor-?, major candidate gene in the pathogenesis of RA. Gene polymorphisms occurring in this pro-inflammatory cytokine may increase the risk of RA. This study aimed to evaluate the association between polymorphisms in TNF-? gene at location -308(rs1800629), -238(rs361525) and -376(1800750) (G/A) and RA susceptibility. The study also evaluated the effects of these polymorphisms on their corresponding gene levels in serum.Methods: This case-control study was conducted on 49 individuals (30 RA patients and 19 age- and sex-matched healthy volunteers as controls). Genomic DNA extracted from all participant blood, then amplified by PCR and genotyped by sequencing.Additionally, the serum level of TNF-? was quantified using an enzyme-linked immunosorbent assay (ELISA).Results: The results showed that thehomozygosity for the TNF-? -308 G allele significantly act as a genetic factor associated with increased RA risk (p = 0.029, OR: 4.727, 95%CI: 1.175–19.016). The A allele of -238 and -376 polymorphisms may act as a possible risk factor for RA (OR: 7.63, 95%CI:0.409-14.07; OR:6.13, 95%CI:.0.32-11.214). However, no significant differences were observed.Conclusion: The GG genotype ofTNF-? -308 SNP associated with increased rheumatoid arthritis risk.

show abstract

Universal Primers for Amplification of TNF-α -308 Promoter Region

Cited by 2 publications

References 10 publications

Biogenetic Markers for Predicting Response to Immunotherapy in Rheumatoid Arthritis

Biogenetic Markers for Predicting Response to Immunotherapy in Rheumatoid Arthritis

Association of genetic variation in tumor necrosis factor-α gene with susceptibility to rheumatoid arthritis in southern Iraq

Contact Info

Product

Resources

About