Unravelling the composition of soil belowground microbial community before sowing transgenic cotton

Abstract

The composition of rhizosphere microorganisms in soils can vary greatly across space, plant species, soil type, root architecture and growth stage (Berg and Smalla 2009). Physicochemical and biological features have an important role in the soil for the establishment of plant-microbe interactions (Janssen 2006). As it was demonstrated, soil pH, structure, oxygen and nutrition levels in the rhizosphere differ from those in the bulk soil (Roesch et al. 2007). The soil is considered to harbour the most diverse bacterial communities on earth providing habitats for them (Roesch et al. 2007). Soil microbial communities play an important role in plant health, soil quality and ecosystem sustainability of agricultural systems (Rincon-Florez et al. 2013). Bacterial communities are important drivers for all biogeochemical cycles in terrestrial ecosystems and participate in most nutrient transformations in soil (Roesch et al. 2007, Rincon-Florez et al. 2013). There are biotic and abiotic factors that are assumed to influence the structural and functional diversity of bacterial communities in the rhizosphere soil, such as climate, season, herbicide application, management practices (Galazka et al. 2017a,b), integrated livestock-crop system (Acosta-Martínez Soils harbour enormously diverse bacterial communities that interact specifically with plants generating beneficial interactions between them. This study was the first approach to assess bacterial communities before sowing with three cotton genotypes, including both transgenic and conventional ones. The structure of bacterial communities was identified using the next generation sequencing analysis, ion torrent PGM (Personal Genome Machine™) sequencer technology, based on the V2-V3 16S rRNA gene region. Quantitative insights into microbial ecology pipeline were used to identify the structure and diversity of bacterial communities in bulk soil samples collected in the northeast of Mexico. Bulk soil textures and chemical properties, including most nutrients, were homogeneous in these bulk soil samples. Relative abundance analysis showed similar bacterial community structures. Dominant taxonomic phyla were Proteobacteria, Firmicutes, Acidobacteria, Actinobacteria, Gemmatimonadetes and Bacteroidetes, whereas the main families were Bacillaceae, Chitinophagaceae and Rhodospirillaceae with an abundance average of BS1 (bulk soil sample), BS2 and BS3 (24.85, 19.74 and 19.71%, respectively). Alpha diversity analysis showed a high diversity (Shannon and Simpson index) and a large value of the observed species found in bulk soils samples. These results allowed establishing the previous bacterial structural community in an unused soil before sowing it with a transgenic crop for the first time.

Assessment of the Microbial Communities in Soil Contaminated with Petroleum Using Next-Generation Sequencing Tools

“…The total number of species observed was 877 for SB.R1, 1843 for SB.R2, 502 for ST.R1 and 2048 for ST.R2, respectively (Figure 6). The number of species found in the contaminated soils of Burgos, Tamaulipas was low compared to our previous report on the bulk soils of Tamaulipas, where the identified average was 6208 species [45]. This variation could be associated with the contamination of the Burgos soil, requiring adaptation by the bacteria living in it.…”

“…Simpson's index shows values of dominance for SB.R1 = 0.9046, SB.R2 = 0.9658, ST.R1 = 0.9147 and ST.R2 = 0.9460 with a similar distribution (Figure 6). nated soils of Burgos, Tamaulipas was low compared to our previous report on the bulk soils of Tamaulipas, where the identified average was 6208 species [45]. This variation could be associated with the contamination of the Burgos soil, requiring adaptation by the bacteria living in it.…”

“…The differences in bacterial composition as compared to the findings from this study may be associated with differences in soil physicochemical properties since the physicochemical properties of soils play a significant role in shaping the microbial communities in the soil [25,54]. We conducted a study where we determined the bacterial composition from bulk soil samples from Tamaulipas, and we found that the main phyla were Proteobacteria, Firmicutes, Acidobacteria, Actinobacteria, Gemmatimonadetes, and Bacteroidetes had the highest diversity according to the Shannon and Simpson index [45].…”

“…The quantity of purified DNA was measured using a NanoDrop 2000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA). Nested PCR was performed using the pair of primers 27F (GAGAGTTTGATCCTGGCTCAG) and 1495R (CTACGGCTAC-CTTGTTACGA) to amplify the 16S rRNA gene from the extracted community DNA [45,46].…”

“…Then, these reads were trimmed to remove tags and primers. The trimmed reads were quality filtered with Trimmomatic (quality score > 20, read length = 150-200 bp), according to Vital-López et al (2017) [45]. The obtained sequences were then analyzed on QIIME version 1.9 [49].…”