Using the GEMM-ESC strategy to study gene function in mouse models

Huijbers, Ivo J.; Bravo, Jessica Del; Ali, Rahmen Bin; Pritchard, Colin E.J.; Braumuller, Tanya M.; Miltenburg, Martine H. van; Henneman, Linda; Michalak, Ewa M.; Berns, Anton; Jonkers, Jos

doi:10.1038/nprot.2015.114

Cited by 43 publications

(28 citation statements)

References 59 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Some groups have expedited this process by targeting new alleles in embryonic stem cells derived from pre-existing GEMMs (GEMM-ESCs), an approach that shows excellent potential for streamlined and high-throughput studies (Huijbers et al, 2014, 2015; Henneman et al, 2015). Others meanwhile have applied inducible in vivo short hairpin RNA (shRNA)-based knockdown as a means to investigate loss of specific tumour suppressor genes without the need for protracted breeding programmes (Ebbesen et al, 2016).…”

Section: The Impact Of Technological Advances On Breast Cancer Modelsmentioning

confidence: 99%

In vivomodels in breast cancer research: progress, challenges and future directions

Holen

Speirs

Morrissey

et al. 2017

Disease Models &Amp; Mechanisms

146

121

View full text Add to dashboard Cite

Research using animal model systems has been instrumental in delivering improved therapies for breast cancer, as well as in generating new insights into the mechanisms that underpin development of the disease. A large number of different models are now available, reflecting different types and stages of the disease; choosing which one to use depends on the specific research question(s) to be investigated. Based on presentations and discussions from leading experts who attended a recent workshop focused on in vivo models of breast cancer, this article provides a perspective on the many varied uses of these models in breast cancer research, their strengths, associated challenges and future directions. Among the questions discussed were: how well do models represent the different stages of human disease; how can we model the involvement of the human immune system and microenvironment in breast cancer; what are the appropriate models of metastatic disease; can we use models to carry out preclinical drug trials and identify pathways responsible for drug resistance; and what are the limitations of patient-derived xenograft models? We briefly outline the areas where the existing breast cancer models require improvement in light of the increased understanding of the disease process, reflecting the drive towards more personalised therapies and identification of mechanisms of drug resistance.

show abstract

Section: The Impact Of Technological Advances On Breast Cancer Modelsmentioning

confidence: 99%

In vivomodels in breast cancer research: progress, challenges and future directions

Holen

Speirs

Morrissey

et al. 2017

Disease Models &Amp; Mechanisms

146

121

View full text Add to dashboard Cite

show abstract

“…Nontransduced cells were used as a negative control in all genomic DNA amplifications, and only TIDE outputs with R 2 > 0.9 were considered. Inversion of the CAG promoter (Huijbers et al 2015) of the Akt-E17K conditional allele was detected as described (Huijbers et al 2014) with a shared FW primer located on Lox66 (primer 1, GGCCGGCCATAACTTCGTATAATG) and two RV primers-one located in the vector backbone (primer 2, CTGCGTTATCCCCTGATTCTGTGG) to detect the nonrecombined allele (product size 897 base pairs [bp]) and one located in the hygromycin-B resistance gene (primer 3, CCTACATC GAAGCTGAAAGCACGAG) to identify the recombined allele (product size 1054 bp). Inversion of the CAG promoter of the Cas9 conditional allele was detected using the Q5 kit to amplify the Col1a1 locus with a shared FW primer located on the CAG promoter itself (primer 1, CTTCTCCCTCTCCAGCCTCGGG) and two RV primers-one located on the hygromycin-B resistance gene (primer 2, CATCAGGTCGGAGACGCTGTCG) and one located on the Cas9 shuttle (primer 3, TCGACGGA TCTTGGGAGGCCTA).…”

Section: Genomic Dna Isolation Pcr Amplification and Tide Analysismentioning

confidence: 99%

“…42229) cDNAs were sequence-verified and inserted as FseI-PmeI and BamHI fragments, respectively, into the Frt-invCag-IRES-Luc vector, resulting in Frt-invCagAktE17K-IRES-Luc and Frt-invCag-Cas9-IRES-Luc. Flp-mediated integration of the shuttle vectors in WapCre;Cdh1 F/F ; Col1a1 frt/+ GEMM-ESC clones was performed as described (Huijbers et al 2015). Chimeric animals were crossed with WapCre;Cdh1 F/F and Cdh1 F/F animals to generate the cohorts.…”

Section: Micementioning

confidence: 99%

Modeling invasive lobular breast carcinoma by CRISPR/Cas9-mediated somatic genome editing of the mammary gland

et al. 2016

Self Cite

View full text Add to dashboard Cite

Large-scale sequencing studies are rapidly identifying putative oncogenic mutations in human tumors. However, discrimination between passenger and driver events in tumorigenesis remains challenging and requires in vivo validation studies in reliable animal models of human cancer. In this study, we describe a novel strategy for in vivo validation of candidate tumor suppressors implicated in invasive lobular breast carcinoma (ILC), which is hallmarked by loss of the cell-cell adhesion molecule E-cadherin. We describe an approach to model ILC by intraductal injection of lentiviral vectors encoding Cre recombinase, the CRISPR/Cas9 system, or both in female mice carrying conditional alleles of the Cdh1 gene, encoding for E-cadherin. Using this approach, we were able to target ILC-initiating cells and induce specific gene disruption of Pten by CRISPR/Cas9-mediated somatic gene editing. Whereas intraductal injection of Cas9-encoding lentiviruses induced Cas9-specific immune responses and development of tumors that did not resemble ILC, lentiviral delivery of a Pten targeting single-guide RNA (sgRNA) in mice with mammary gland-specific loss of E-cadherin and expression of Cas9 efficiently induced ILC development. This versatile platform can be used for rapid in vivo testing of putative tumor suppressor genes implicated in ILC, providing new opportunities for modeling invasive lobular breast carcinoma in mice.

show abstract

“…An alternative approach is to introduce candidate driver mutations into an established GEMM of the cancer type in which the mutations were identified, in order to study their effect on tumourigenesis (figure 5 a ). These additional mutations can be introduced using either germline approaches (such as the GEMM-ESC strategy [123]) or somatic approaches (e.g. via injection of viral vectors), as described in previous sections.…”

Section: Validating and Characterizing Candidate Driver Genesmentioning

confidence: 99%

Mouse models in the era of large human tumour sequencing studies

2018

View full text Add to dashboard Cite

Cancer is a complex disease in which cells progressively accumulate mutations disrupting their cellular processes. A fraction of these mutations drive tumourigenesis by affecting oncogenes or tumour suppressor genes, but many mutations are passengers with no clear contribution to tumour development. The advancement of DNA and RNA sequencing technologies has enabled in-depth analysis of thousands of human tumours from various tissues to perform systematic characterization of their (epi)genomes and transcriptomes in order to identify (epi)genetic changes associated with cancer. Combined with considerable progress in algorithmic development, this expansion in scale has resulted in the identification of many cancer-associated mutations, genes and pathways that are considered to be potential drivers of tumour development. However, it remains challenging to systematically identify drivers affected by complex genomic rearrangements and drivers residing in non-coding regions of the genome or in complex amplicons or deletions of copy-number driven tumours. Furthermore, functional characterization is challenging in the human context due to the lack of genetically tractable experimental model systems in which the effects of mutations can be studied in the context of their tumour microenvironment. In this respect, mouse models of human cancer provide unique opportunities for pinpointing novel driver genes and their detailed characterization. In this review, we provide an overview of approaches for complementing human studies with data from mouse models. We also discuss state-of-the-art technological developments for cancer gene discovery and validation in mice.

show abstract

Using the GEMM-ESC strategy to study gene function in mouse models

Cited by 43 publications

References 59 publications

In vivomodels in breast cancer research: progress, challenges and future directions

In vivomodels in breast cancer research: progress, challenges and future directions

Modeling invasive lobular breast carcinoma by CRISPR/Cas9-mediated somatic genome editing of the mammary gland

Mouse models in the era of large human tumour sequencing studies

Contact Info

Product

Resources

About