Using the tannase gene to rapidly and simply identify Staphylococcus lugdunensis

Noguchi, Norihisa; Goto, Keiko; Ro, Tokihiro; Narui, Koji; Ko, Mari; Nasu, Yutaka; Utsumi, Kenta; Takazawa, Kenji; Sasatsu, Masanori

doi:10.1016/j.diagmicrobio.2009.03.028

Cited by 31 publications

(18 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Only very recently the first PCR protocol for detection of the species has been published targeting the tanA gene (5). Another suitable species-specific marker for S. lugdunensis identification could be the fbl gene, which codes for a surface-located fibrinogen-binding adhesin, referred to as Fbl protein (6,7).…”

Section: Introductionmentioning

confidence: 99%

fbl gene as a species‐specific target for Staphylococcus lugdunensis identification

Chatzigeorgiou

Siafakas

Petinaki

et al. 2010

Clinical Laboratory Analysis

View full text Add to dashboard Cite

Staphylococcus lugdunensis is an unusually virulent coagulase-negative species, associated with severe infections. The present report describes the development of a single-step, species-specific PCR protocol for S. lugdunensis identification. fbl gene, encoding a fibrinogen-binding adhesin, was exploited and assessed as a suitable nucleic acid target. The gene was detected in all 17 S. lugdunensis isolates examined, while no amplification product was obtained from 98 isolates representing 11 staphylococcal and 17 nonstaphylococcal species. Forty-seven percent of the S. lugdunensis strains produced a positive slide coagulase reaction, which is consistent with varying levels of Fbl protein expression within the species.

show abstract

Section: Introductionmentioning

confidence: 99%

fbl gene as a species‐specific target for Staphylococcus lugdunensis identification

Chatzigeorgiou

Siafakas

Petinaki

et al. 2010

Clinical Laboratory Analysis

View full text Add to dashboard Cite

show abstract

“…Species-specific PCRs were used as the reference method in case of discrepant identification results (Table 2). Forty-six strains of 19 species (excluding meticillin-sensitive S. aureus, S. hyicus and S. xylosus) were identified using amplification and sequencing of the sodA gene (Martineau et al, 2000;Poyart et al, 2001;Shrestha et al, 2002;Stuhlmeier & Stuhlmeier, 2003;Morot-Bizot et al, 2004;Iwase et al, 2007;Hauschild & Stepanovic, 2008;Noguchi et al, 2010): Staphylococcus arlettae (n51), Staphylococcus capitis (n54), S. cohnii (n51), S. epidermidis (n53), S. haemolyticus (n56), S. hominis (n516), S. lugdunensis (n55), S. saprophyticus (n51), S. schleiferi (n52), Staphylococcus succinus (n55) and S. warneri (n52).…”

Section: Methodsmentioning

confidence: 99%

Evaluation of species-specific score cut-off values for various Staphylococcus species using a MALDI Biotyper-based identification

Richter

Hollstein

Woloszyn

et al. 2012

Journal of Medical Microbiology

View full text Add to dashboard Cite

Although previous studies investigating the MALDI Biotyper database (matrix-assisted laser desorption/ionization time-of-flight mass spectrometry-based identification) have proven its high accuracy for bacterial identification, the studies differed in sample preparation, number of replicates, quantity of shots and target types used. In particular, the score cut-off values of special importance for reliable species identification varied. The aim of the present study was to identify species-specific differences in the mean score values for staphylococci. Cut-off values recommended by the manufacturer were adapted using the 20th percentile to rule out unknown score-modifying factors, even though the specificity was high and the lowest cut-off values would also yield an accurate result. Whilst correct species diagnosis was obtained in 97.32 % of samples (1382/1420), only 220 of all duplicates (15.49 %) revealed a score of ¢2.3, whilst 968 (68.17 %) had a score between 2.0 and 2.299, and 194 (13.66 %) had a score of ,2.0. Ten of 21 species had a calculated 20th percentile of ,2.0 and one species of ,1.7. In conclusion, the use of species-specific cut-off values improves the relative sensitivity of species identification in staphylococci.

show abstract

“…The second gene was fbl gene that coded to fibrinogen binding protein. The third gene that was detected in the present study was mecA that was responsible for oxacillin/methicillin resistance by coding for penicillin binding protein (PBP2a); the primer sequence of these genes were ( tanA F : AGCATGGGCAATAACAGCAGTAA, tanA R : GCTGCGCCAATTTGTTCTAAATAT) 239 bp; the conditions were 95°C 3 min 1x, 94°C 20 sec, 60°C 20 sec 25x, 72°C, 20 sec, and 72°C 5 min 1x [12]. …”

Section: Methodsmentioning

confidence: 80%

First Record of Isolation and Characterization of Methicillin ResistantStaphylococcus lugdunensisfrom Clinical Samples in Iraq

Al-Charrakh

Obayes

2014

BioMed Research International

View full text Add to dashboard Cite

This study was conducted to determine the frequency of Staphylococcus lugdunensis in different clinical samples. Out of 690 clinical samples, a total of 178 coagulase negative staphylococci (CoNS) isolates were recovered. CoNS were identified as 10 different species; 22 isolates belonged to Staphylococcus lugdunensis. Two specific genes for S. lugdunensis were used ( tanA gene and fbl gene) to confirm identification. Both of these specific genes were detected in 15 (68.1%) of 22 isolates that were identified phenotypically. The results of oxacillin MIC showed that 7 of the 15 (46.6%) S. lugdunensis isolates were oxacillin resistant. The antibiotic susceptibility testing against 16 antibiotics showed that resistance rates were variable towards these antibiotics. Eight of fifteen S. lugdunensis isolates (53.3%) were β-lactamase producer. Results of molecular detection of mecA gene found that mecA gene was detected in 6 (40%) of 15 S. lugdunensis. All of these 6 isolates (S1, S2, S3, S4, S5, and S6) were resistant to oxacillin. One isolate (S7) was resistant to oxacillin but mecA was not detected in this isolate. This study is a first record of isolation and characterization of methicillin resistant S. lugdunensis (MRSL) from clinical samples in Iraq.

show abstract

Using the tannase gene to rapidly and simply identify Staphylococcus lugdunensis

Cited by 31 publications

References 10 publications

fbl gene as a species‐specific target for Staphylococcus lugdunensis identification

fbl gene as a species‐specific target for Staphylococcus lugdunensis identification

Evaluation of species-specific score cut-off values for various Staphylococcus species using a MALDI Biotyper-based identification

First Record of Isolation and Characterization of Methicillin ResistantStaphylococcus lugdunensisfrom Clinical Samples in Iraq

Contact Info

Product

Resources

About