V-gene amplification revisited – An optimised procedure for amplification of rearranged human antibody genes of different isotypes

Lim, Theam Soon; Mollova, Svetlana; Rubelt, Florian; Sievert, Volker; Dübel, Stefan; Lehrach, Hans; Konthur, Zoltán

doi:10.1016/j.nbt.2010.01.001

Cited by 28 publications

(16 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…B cell populations were used to generate total cDNA, and human VH, Vλ, and Vκ genes were amplified using a well characterized and extensively validated set of 5′ oligonucleotide primers and a second set of five 3′ primers complementary to the constant regions of IgM, IgG1, IgG2, IgG3 and IgG4 [20], [21]. To place VDJ usage, CDR3 composition and somatic hypermutation (SHM) rates in the HuMs B-cell populations in context, we also amplified V genes from peripheral blood mononuclear cells (PBMCs) from two healthy adult human volunteers (HuPBC-1, HuPBC-2).…”

Section: Resultsmentioning

confidence: 99%

“…Total RNA was isolated from naïve or total B cells from humanized mouse spleens, pooled humanized mice immature B cells, or human PBMCs, and first-strand Oligo-dT cDNA was generated, followed by PCR to amplify the V λ , V κ , and V H genes separately with a respective standard mix of optimized primers as shown in Table 1 [21]. Specifically, naïve or total B cells from humanized mouse spleens, pooled humanized mice immature B cells, or human PBMCs were lysed using the TRI reagent.…”

Section: Methodsmentioning

confidence: 99%

“…First-strand cDNA generation was performed with 500 ng of isolated total RNA using SuperScript RT II kit (Invitrogen) and Oligo-dT primer. After cDNA construction, PCR amplification was performed to amplify the V λ , V κ , and V H genes separately with a respective standard mix of primers described previously [20], [21]. PCR reactions were carried out as described previously [22] using the following conditions: 92°C denaturation for 3 min; 92°C 1 min, 50°C 1 min, 72°C 1 min for 4 cycles; 92°C 1 min, 55°C 1 min, 72°C 1 min for 4 cycles; 92°C 1 min, 63°C 1 min, 72°C 1 min for 20 cycles; and a final extension of 72°C for 7 minutes.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Antibody Repertoires in Humanized NOD-scid-IL2Rγnull Mice and Human B Cells Reveals Human-Like Diversification and Tolerance Checkpoints in the Mouse

et al. 2012

View full text Add to dashboard Cite

Immunodeficient mice reconstituted with human hematopoietic stem cells enable the in vivo study of human hematopoiesis. In particular, NOD-scid-IL2Rγnull engrafted mice have been shown to have reasonable levels of T and B cell repopulation and can mount T-cell dependent responses; however, antigen-specific B-cell responses in this model are generally poor. We explored whether developmental defects in the immunoglobulin gene repertoire might be partly responsible for the low level of antibody responses in this model. Roche 454 sequencing was used to obtain over 685,000 reads from cDNA encoding immunoglobulin heavy (IGH) and light (IGK and IGL) genes isolated from immature, naïve, or total splenic B cells in engrafted NOD-scid-IL2Rγnull mice, and compared with over 940,000 reads from peripheral B cells of two healthy volunteers. We find that while naïve B-cell repertoires in humanized mice are chiefly indistinguishable from those in human blood B cells, and display highly correlated patterns of immunoglobulin gene segment use, the complementarity-determining region H3 (CDR-H3) repertoires are nevertheless extremely diverse and are specific for each individual. Despite this diversity, preferential DH-JH pairings repeatedly occur within the CDR-H3 interval that are strikingly similar across all repertoires examined, implying a genetic constraint imposed on repertoire generation. Moreover, CDR-H3 length, charged amino-acid content, and hydropathy are indistinguishable between humans and humanized mice, with no evidence of global autoimmune signatures. Importantly, however, a statistically greater usage of the inherently autoreactive IGHV4-34 and IGKV4-1 genes was observed in the newly formed immature B cells relative to naïve B or total splenic B cells in the humanized mice, a finding consistent with the deletion of autoreactive B cells in humans. Overall, our results provide evidence that key features of the primary repertoire are shaped by genetic factors intrinsic to human B cells and are principally unaltered by differences between mouse and human stromal microenvironments.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Antibody Repertoires in Humanized NOD-scid-IL2Rγnull Mice and Human B Cells Reveals Human-Like Diversification and Tolerance Checkpoints in the Mouse

et al. 2012

View full text Add to dashboard Cite

show abstract

“…Finally beads were suspended in 2.85 mL cold RT-PCR mixture (Quanta OneStep Fast, VWR) containing 0.05 wt% BSA (Invitrogen Ultrapure BSA, 50 mg/mL) and primer sets for V H and V L linkage amplification (Supplementary Fig. 1 and Supplementary Table 5) 3,25 . The suspension containing the poly(dT) magnetic beads was added dropwise to a stirring IKA dispersing tube (DT-20, VWR) containing 9 mL chilled oil phase (molecular biology grade mineral oil with 4.5% Span-80, 0.4% Tween 80, 0.05% Triton X-100, v/v%, Sigma-Aldrich, St. Louis, MO), and the mixture was agitated for 5 min at low speed.…”

Section: Methodsmentioning

confidence: 99%

High-throughput sequencing of the paired human immunoglobulin heavy and light chain repertoire

et al. 2013

View full text Add to dashboard Cite

Each B-cell receptor consists of a pair of heavy and light chains. High-throughput sequencing can identify large numbers of heavy- and light-chain variable regions (VH and VL) in a given B-cell repertoire, but information about endogenous pairing of heavy and light chains is lost after bulk lysis of B-cell populations. Here we describe a way to retain this pairing information. In our approach, single B cells (>5 × 104 capacity per experiment) are deposited in a high-density microwell plate (125 pl/well) and lysed in situ. mRNA is then captured on magnetic beads, reverse transcribed and amplified by emulsion VH:VL linkage PCR. The linked transcripts are analyzed by Illumina high-throughput sequencing. We validated the fidelity of VH:VL pairs identified by this approach and used the method to sequence the repertoire of three human cell subsets—peripheral blood IgG+ B cells, peripheral plasmablasts isolated after tetanus toxoid immunization and memory B cells isolated after seasonal influenza vaccination.

show abstract

“…For CDR3 mutagenesis, primers used for VH framework were VH-NcoI-Fw (ACATGCCATGGCCGAGGTGCAGC), VH-Tom-Fr3-phos-Rv (5-phos-ACAGTAATATACGGC) and synthetic CDR3 oligonucleotides (GACGGTGACCAGGGTTCCCTGGCCCCAGTAGTCAAA MNNMNNMNNMNN TTTCGCACAGTAATATACGGCCGT). Kappa light chain variable region gene sequence was amplified using cDNA template, synthesized from RNA that was extracted from human PBMCs according to Lim et al (42); amplification of VK genes from family 2, 4, and 6, were conducted with the primers VK246-Sall-Fw (TGTGACAAAGTCGACGGATATTGTGMTGACBCAGWCTCC) and HscFv kappa-NotI-Rv (ATGATGATGTGCGGCCGCGAAGACAGATGGTGCAGCCACAGT). All PCR products were purified using the PCR Purification Kit (Qiagen) and eluted in 30 or 50 L of distilled water.…”

Section: Methodsmentioning

confidence: 99%

Directed Evolution of Nucleotide-Based Libraries Using Lambda Exonuclease

et al. 2012

Self Cite

View full text Add to dashboard Cite

Directed evolution of nucleotide libraries using recombination or mutagenesis is an important technique for customizing catalytic or biophysical traits of proteins. Conventional directed evolution methods, however, suffer from cumbersome digestion and ligation steps. Here, we describe a simple method to increase nucleotide diversity using single-stranded DNA (ssDNA) as a starting template. An initial PCR amplification using phosphorylated primers with overlapping regions followed by treatment with lambda exonuclease generates ssDNA templates that can then be annealed via the overlap regions. Double-stranded DNA (dsDNA) is then generated through extension with Klenow fragment. To demonstrate the applicability of this methodology for directed evolution of nucleotide libraries, we generated both gene shuffled and regional mutagenesis synthetic antibody libraries with titers of 2×108 and 6×107, respectively. We conclude that our method is an efficient and convenient approach to generate diversity in nucleic acid based libraries, especially recombinant antibody libraries.

show abstract

V-gene amplification revisited – An optimised procedure for amplification of rearranged human antibody genes of different isotypes

Cited by 28 publications

References 45 publications

Antibody Repertoires in Humanized NOD-scid-IL2Rγnull Mice and Human B Cells Reveals Human-Like Diversification and Tolerance Checkpoints in the Mouse

Antibody Repertoires in Humanized NOD-scid-IL2Rγnull Mice and Human B Cells Reveals Human-Like Diversification and Tolerance Checkpoints in the Mouse

High-throughput sequencing of the paired human immunoglobulin heavy and light chain repertoire

Directed Evolution of Nucleotide-Based Libraries Using Lambda Exonuclease

Contact Info

Product

Resources

About