Variability of Bacterial Biofilms of the “Tina” Wood Vats Used in the Ragusano Cheese-Making Process

Abstract

Ragusano cheese is a "protected denomination of origin" cheese made in the Hyblean region of Sicily from raw milk using traditional wooden tools, without starter. To explore the Ragusano bacterial ecosystem, molecular fingerprinting was conducted at different times during the ripening and biofilms from the wooden vats called "tinas" were investigated. Raw milks collected at two farm sites, one on the mountain and one at sea level, were processed to produce Ragusano cheese. Raw milk, curd before and after cooking, curd at stretching time (cheese 0 time), and cheese samples (4 and 7 months) were analyzed by PCR-temporal temperature gel electrophoresis (PCR-TTGE) and by classical enumeration microbiology. With the use of universal primers, PCR-TTGE revealed many differences between the raw milk profiles, but also notable common bands identified as Streptococcus thermophilus, Lactobacillus lactis, Lactobacillus delbrueckii, and Enterococcus faecium. After the stretching, TTGE profiles revealed three to five dominant species only through the entire process of ripening. In the biofilms of the two tinas used, one to five species were detected, S. thermophilus being predominant in both. Biofilms from five other tinas were also analyzed by PCR-TTGE, PCR-denaturating gradient gel electrophoresis, specific PCR tests, and sequencing, confirming the predominance of lactic acid bacteria (S. thermophilus, L. lactis, and L. delbrueckii subsp. lactis) and the presence of a few high-GC-content species, like coryneform bacteria. The spontaneous acidification of raw milks before and after contact with the five tinas was followed in two independent experiments. The lag period before acidification can be up to 5 h, depending on the raw milk and the specific tina, highlighting the complexity of this natural inoculation system. Ragusano cheese ("protected denomination of origin" since 1996) is a brine-salted pasta filata raw-milk cheese that is aged for 6 to 12 months and is produced on farms in eastern Sicily (16). No starters are added in the cheese-making process, and lactic acid is produced by natural milk flora and desirable flora from the surface of the traditional wooden cheese vats (tinas); the respective contributions of these two bacterial sources, the raw milk and the tina biofilm, are still not completely elucidated. Preliminary studies were performed on the Ragusano cheese bacterial ecosystem during the ripening by traditional microbiology after plating and by random amplified polymorphic DNA analysis of isolated clones (7). Forty different populations were identified, which can be predominant at different times of the ripening, among them Lactococcus lactis, Enterococcus sp., Streptococcus thermophilus, Streptococcus macedonicus, and various mesophilic lactobacilli. With both approaches, stretching was found to induce a strong modification of the bacterial profile. The presence of L. lactis, S. thermophilus, and Streptococcus waius was detected (6) in the wooden tina vat. However, considering the limits of traditional mic...

World wide traditional cheeses: Banned for business?

“…The presence of a bacterial biofilm was found on the surface of "tina wooden vat" that is used in the Ragusano PDO cheesemaking process, where no starter cultures are allowed to be used [33]. In fact, the bacterial ecosystem of the tina biofilm quickly and efficiently releases lactic acid bacteria into the raw milk, thereby making the acidification process faster.…”

Proteolysis, microbiology, volatiles and sensory evaluation of Algerian traditional cheeseBouhezzamade using goat’s raw milk

“…DNA extraction from cheese samples and amplification of the V3 region (16S rRNA gene) were performed as described by Licitra et al [20] Amplification according to the protocol proposed by Parayre et al [21] , in the region of the DNA V3 gene encoding 16S ribosomal RNA (16S rDNA) by PCR using universal primers V3P3-GC-Clamp (5ʹGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCGGGGGGGCCTCGGGAGGCAGCAG-3ʹ) and V3P2 (5ʹ-ATTACCGCGGCTG CTGG-3 ') (Sigma, Italy). These primers give the PCR products about 233 base pairs.…”

Characterization of thermophilic streptococci isolated from rustic white cheese

“…It is traditionally manufactured from raw cow s or sheep s milk. The procedure of using unpasteurized milk without a starter in order to conserve microflora has received special attention (ElBaradei et al, 2007;Licitra et al, 2007;Randazzo et al, 2002;Terzic-Vidojevic et al, 2007). The thermophilic streptococci play an important role in the manufacture of white cheese (Stiles and Holzapfel, 1997), while other types (Streptococcus pyogenes, S. sobrinus, S. mutans and Enterococcus faecalis) have pathogenic properties (Molinari and Chhatwal, 1999).…”