Variant Phenotype of Best Vitelliform Macular Dystrophy Associated with Compound Heterozygous Mutations inVMD2

Abstract

A previously undescribed severe form of Best macular dystrophy is associated with compound heterozygous mutations in VMD2.

Frequency, Genotype, and Clinical Spectrum of Best Vitelliform Macular Dystrophy: Data From a National Center in Denmark

“…Yet, values around 1.5 are ambiguous, and convincing Best disease cases with normal Arden ratios have been reported. 8,19 Familial occurrence, with at least one relative affected, was seen in all families described, except in two families (Fig. 2).…”

A novel compound heterozygous mutation in the BEST1 gene causes autosomal recessive Best vitelliform macular dystrophy

“…While over 100 different BEST1 mutations have been CCATGGCCCCTCTAATTTCT 363 2 GAGGTCCAGAGCAGGGAAGGGT CAGCCCCAGCCACATCCTT 327 3 GAGGCAGTCCCACTCCTACC GCAGCTCCTCGTGATCCTC 278 4 CTCCTGCCCAGGCTTCTACGT CCACCCATCTTCCATTCCT 326 5 GGTTCCTATAGGTCAGCAGGTG GAAACCTTGTTTCCTGTGGAC 303 6 TGGTACCTGGAGAAGAGGTG CCTTGGTCCTTCTAGCCTCA 219 7 CATCCTGATTTCAGGGTTCC GACACTGCATCCTCGTCTCA 298 8 ATGGGGTGTGGAAATAGCAG GAGGGGAAGGGTTGATCATT 290 9 CTCCAAGTCATCAGGCACAT GCAGACCCCTGCACTAGGAG 284 10-1 GGTGTTGGTCCTTTGTCCAC TGACACTGTGAAGCTTTGACG 430 10-2 CTGGAAGCTTAAGGCTGTGG TAGGCTCAGAGCAAGGGAAG 481 11 CTTTGCCCTCCTACTGCAAC TCCTTAAGTGCCGTTGTTCA 487 described in families affected by Best disease, [13][14][15][16][17] only a few combinations of compound heterozygous mutations in arBVMD have been reported. [1][2][3][4][5]11 In our study, the affected children were found to have a combination of two heterozygous mutations: c.122T4C (L41P) and c. 602T4C (I201T). The L41P mutation has 1 The I201T mutation has also been implicated in arBVMD.…”

“…20 Previous publications have discussed that the clinical presentation of cases of compound arBVMD are noticeably different from the autosomal dominant form. 1,11,13 The most-reported distinguishing feature of arBVMD is extrafoveal and extramacular subretinal deposits.…”

“…6,[8][9][10] To date, several mutations in arBVMD cases have been reported. [1][2][3]5,11,12 These include homozygous and combinations of nonsense or missense mutations. In all of these cases, patients presented with central vision loss, characteristic retinopathy, absence of electro-oculogram light rise, and a reduced electroretinogram.…”

Best vitelliform macular dystrophy: literature review

“…The variable phenotype in dominant heterozygous Best VMD is highlighted in most studies [73,74]. Compound heterozygous, biallelic recessive or homozygous dominant mutations in BEST1 may confer a particulary severe phenotype, featuring retinal lesions, in additional to VMD [75]. Different mutations might cause Best disease by different mechanisms.…”