Variants of Genes Involved in Metabolism of Folate among Patients with Breast Cancer: Association of TYMS 3R Allele with Susceptibility to Breast Cancer and Metastasis

Abstract

Background & Objective: Breast cancer (BC) is known to be the most prevalent cancer among women. One-carbon metabolism disturbance might play an important role in the etiology of BC. The present study aimed to investigate the thymidylate synthase (TYMS), 5-methyltetrahydrofolate-homocysteine methyltransferase (MTR), and methionine synthase reductase (MTRR) variants as good candidates for studying the role of genetic variants of folate metabolizing enzymes in the risk of BC. Methods: The present case-control study includes 100 BC patients and 141 healthy females. The TYMS 2R/3R (rs34743033), MTR c.2756A>G (rs1805087), and MTRR c.66A>G (rs1801394) variants were detected by polymerase chain reaction (PCR), PCR-restriction fragment length polymorphism (RFLP), and a designed amplification-refractory mutation system (ARMS) method, respectively. Results: The 3R allele of TYMS enhanced the risk of BC by 2.84-fold ( P <0.001). In the presence of TYMS 3R/3R, compared to TYMS 2R/3R, there was a trend toward enhancing the risk of metastasis by 4.15-fold (95% CI: 0.96-17.85, P =0.055). The frequencies of MTR c.2756A>G and MTRR c.66A>G variants were not significantly different among patients and controls. Conclusion: We observed that the TYMS 3R is a risk allele for susceptibility to BC and this allele may increase the risk of metastasis in BC patients. .

The impact of folate pathway variants on the outcome of methotrexate therapy in rheumatoid arthritis patients

“…It was performed in a 25-μL reaction volume, via 10 pmol forward primer (5′‐GTGGCTCCTGCGTTTCCCCC‐3′), 10 pmol reverse primer (5′-GCTCCGAGCCGGCCACAGGCATGGCGCGG-3), and 12.5 µL COSMO “Hot Start” PCR RED Master Mix (Willowfort, UK). The PCR condition was performed as described previously, with modifications [ 16 ]. It comprised a 5-min initial denaturation at 94 °C, then proceeded to 35 cycles with denaturation for 1 min at 94 °C, annealing at 60 °C for 30 s, extension for 30 s at 72 °C followed by a final extension at 72 °C, for 10 min.…”