Vegfa signaling promotes zebrafish intestinal vasculature development through endothelial cell migration from the posterior cardinal vein

Abstract

The mechanisms underlying organ vascularization are not well understood. The zebrafish intestinal vasculature forms early, is easily imaged using transgenic lines and in-situ hybridization, and develops in a stereotypical pattern thus making it an excellent model for investigating mechanisms of organ specific vascularization. Here, we demonstrate that the sub-intestinal vein (SIV) and supra-intestinal artery (SIA) form by a novel mechanism from angioblasts that migrate out of the posterior cardinal vein and coalesce to form the intestinal vasculature in an anterior to posterior wave with the SIA forming after the SIV. We show that vascular endothelial growth factor aa (vegfaa) is expressed in the endoderm at the site where intestinal vessels form and therefore likely provides a guidance signal. Vegfa/Vegfr2 signaling is required for early intestinal vasculature development with mutation in vegfaa or loss of Vegfr2 homologs causing nearly complete inhibition of the formation of the intestinal vasculature. Vegfc and Vegfr3 function, however, are dispensable for intestinal vascularization. Interestingly, ubiquitous overexpression of Vegfc resulted in an overgrowth of the SIV, suggesting that Vegfc is sufficient to induce SIV development. These results argue that Vegfa signaling directs endothelial cells to migrate out of existing vasculature and coalesce to form the intestinal vessels. It is likely that a similar mechanism is utilized during vascularization of other organs.

The Transcription Factor Bach1 Suppresses the Developmental Angiogenesis of Zebrafish

“…VEGF-A/VEGFR2 signaling is required for early intersegmental vasculature development with mutation in VEGF-aa or loss of VEGFR2 homologs causing nearly complete inhibition of the formation of the ISV [26]. VEGF-A signaling has been shown to direct endothelial cells to migrate out of existing vasculature [28], and impaired endothelial migration was associated with abnormal formation of the ISV [29]. IL-8 is another key proangiogenic factor.…”

ERK activation in endothelial cells is a novel marker during neovasculogenesis

“…VEGFA probes were synthesized from PCR products using the primer (forward: 5′‐TTATTTCTCGCGGCTCTCCTC‐3′, reverse: 5′‐GAAATTAATACGACTCACTATAGGGCATCTTGGCTTTTCACATCTTTCT‐3′) with an integrated T7 promoter site (Koenig et al . ).…”

“…The embryos of ERK monitoring fish with EGFP expression were fixed with 4% PFA. VEGFA probes were synthesized from PCR products using the primer (forward: 5 0 -TTA TTTCTCGCGGCTCTCCTC-3 0 , reverse: 5 0 -GAAATTAA TACGACTCACTATAGGGCATCTTGGCTTTTCACATC TTTCT-3 0 ) with an integrated T7 promoter site (Koenig et al 2016).…”

Cell behaviors and dynamics during angiogenesis

“…Other zebrafish vascular beds that have attracted attention (Fig. 1) include the vasculature of the head and the brain (Gore et al, 2012;Isogai et al, 2001;Kimura et al, 2015;Lenard et al, 2013;Chen et al, 2012), the caudal vein plexus (Wiley et al, 2011) and the subintestinal veins (SIVs) (Goi and Childs, 2016;Hen et al, 2015;Koenig et al, 2016;Lenard et al, 2015;Nicoli et al, 2007). It should be noted, however, that ECs in different vascular beds might use different molecular cues and morphogenetic mechanisms to form vascular tubes.…”