Vidjil: A Web Platform for Analysis of High-Throughput Repertoire Sequencing

Duez, Marc; Giraud, Mathieu; Herbert, Ryan; Rocher, Tatiana; Salson, Mikaël; Thonier, Florian

doi:10.1371/journal.pone.0166126

Cited by 81 publications

(62 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Many computational approaches have been developed in the last decade to process and analyze HTS immune repertoire data , including software tools that can be used to extract TCR or BCR repertoires from raw sequencing reads (e.g., MiXCR, Vidjil, IMSEQ, IgReC ). This typically includes creating a list of clonotypes with determined CDR3, V, D, and J segments and their borders, as well as each clonotype's count and basic error correction, based on the collapsing of similar sequences.…”

Section: Hts‐based Methods Of Immune Repertoire Profilingmentioning

confidence: 99%

T‐cell receptor and B‐cell receptor repertoire profiling in adaptive immunity

2019

View full text Add to dashboard Cite

Summary B‐cell receptors and T‐cell receptors are the key molecules responsible for specific antigen recognition in adaptive immunity. The huge diversity of immune receptor repertoires constrained their comprehensive studies in the past. More recently, however, high‐throughput sequencing based techniques have revolutionized the field of immune receptor repertoire profiling enabling new insights into the development and function of the adaptive immune system. In this review we describe current methods for immune receptor profiling and software tools used for repertoire reconstruction from raw sequencing data. We also provide examples of how immune repertoire profiling can be used to study adaptive immunity in disease and in the course of organ and bone marrow transplantation.

show abstract

Section: Hts‐based Methods Of Immune Repertoire Profilingmentioning

confidence: 99%

T‐cell receptor and B‐cell receptor repertoire profiling in adaptive immunity

2019

View full text Add to dashboard Cite

show abstract

“…Paired reads were merged using FLASH. 21 Repertoire analysis was done using the VIDJIL tool (http://vidjil.org/) 22 Figure 1) and IMGT/HIGHV-QUEST tool (http://imgt.org/). 18,20 Sequencing of IGLV genes on DNA DNA extraction from a lymph node biopsy and sequencing of IGLV gene were done using the EuroClonality/BIOMED-2 guidelines as previously described 23,24 with an IGLV forward consensus primer (5' ATTCTCTGGCTCCAAGTCTGGC 3') specific to the FR3 region and an IGLJ reverse consensus primer (5' CTAGGACGGTGAGCTTGGTCCC 3').…”

Section: Sequencing On Illumina Miseq and Repertoire Analysismentioning

confidence: 99%

Full-length immunoglobulin high-throughput sequencing reveals specific novel mutational patterns in POEMS syndrome

Bender

Javaugue

Saintamand

et al. 2019

Preprint

View full text Add to dashboard Cite

POEMS syndrome is a rare multisystem disease due to an underlying plasma cell (PC) dyscrasia. The pathophysiology of the disease remains unclear but the role of the monoclonal immunoglobulin (Ig) light chain (LC) is strongly suspected, due to the highly restrictive usage of two λ variable (V) domains (IGLV1-40 and IGLV1-44) and the general improvement of clinical manifestations following PC clone-targeted treatment. However, the diagnostic value of Ig LC sequencing, especially in case of incomplete forms of the disease, remains to be determined. Using a sensitive high-throughput Ig repertoire sequencing on RNA (RACE-RepSeq), we detected a λ LC monoclonal expansion in the bone marrow (BM) of 85% of patients with POEMS syndrome, including some in whom bone marrow tests routinely performed to diagnose plasma cell dyscrasia failed to detect λ + monoclonal PCs. Twenty-four of the 30 LC clonal sequences found (80%) were derived from the IGLV1-40 and IGLV1-44 germline genes, two from the closely related IGLV1-36 gene, and all were associated with an IGLJ3*02 junction (J) gene, confirming the high restriction of VJ region usage in POEMS syndrome. RACE-RepSeq VJ full-length sequencing additionally revealed original mutational patterns, the strong specificity of which might crucially help establish or eliminate the diagnosis of POEMS syndrome in uncertain cases. Thus, RACE-RepSeq appears as a sensitive, rapid and specific tool to detect low-abundance PC clones in BM, and assign them to POEMS syndrome, with all the consequences for therapeutic options hereby.

show abstract

“…The resulting fastq files were analyzed using the bioinformatics tools Vidjil (19) and ARResT/Interrogate (20). After the second PCR, the concentration of the resulting products was measured using the Quant-iT™ PicoGreen ® dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, MA).…”

Section: Next-generation Sequencingmentioning

confidence: 99%

“…The raw sequencing data were demultiplexed using the bcl2fastq conversion software (Illumina) with 0 mismatches in barcode sequences allowed. The resulting fastq files were analyzed using the bioinformatics tools Vidjil (19) and ARResT/Interrogate (20). Only clones with a frequency >15% were reported.…”

Section: Next-generation Sequencingmentioning

confidence: 99%

Next‐generation amplicon TRB locus sequencing can overcome limitations of flow‐cytometric Vβ expression analysis and confirms clonality in all T‐cell prolymphocytic leukemia cases

et al. 2018

View full text Add to dashboard Cite

T-cell receptor (TCR) β repertoire analysis can distinguish monoclonal from polyclonal T-cell proliferations and crucially aid in the diagnosis of T-cell malignancies. TCR repertoire can be assessed either by flow cytometry (FCM), or by molecular genetic techniques. We compared the results of parallel analyses of Vβ expression by FCM and TRB rearrangements by DNA-based next-generation sequencing (NGS) in 80 diagnostic peripheral blood samples of patients with T-cell prolymphocytic leukemia (T-PLL) for (1) the diagnosis of clonality and (2) the assessment of dominant Vβ usage. FCM-based analysis of the surface expression was performed using the IOTest Beta Mark kit. The NGS-based analysis employed the multiplex Biomed-2 VB-JB primers. In all the samples, one or two clonal TRB rearrangements were detected by NGS. Although a dominant Vβ domain usage was detected by FCM in only 41/80 (51%) samples, clonality was suspected in all of them. In a total of 12 cases, the FCM missed the clone detected by NGS, despite theoretical coverage by the antibodies, the functionality of the rearrangement, and the expression of TCRαβ on the cell surface. Partly overlapping with those cases, FCM discovered predominant Vβ usage in the T-PLL population that differed from the one detected by NGS in 10 cases. Overall, the concordant NGS and FCM results were obtained on 61/80 (76%) of samples. We conclude that NGS-based TRB analysis can overcome certain limitations of FCM-based analysis by the identification of both productive and nonproductive rearrangements and by covering the whole Vβ spectrum. Currently available FCM analysis of Vβ expression lacks this breadth but has advantages, such as parallel immunophenotyping and a more accurate quantification of the Vβ usage.

show abstract

Vidjil: A Web Platform for Analysis of High-Throughput Repertoire Sequencing

Cited by 81 publications

References 30 publications

T‐cell receptor and B‐cell receptor repertoire profiling in adaptive immunity

T‐cell receptor and B‐cell receptor repertoire profiling in adaptive immunity

Full-length immunoglobulin high-throughput sequencing reveals specific novel mutational patterns in POEMS syndrome

Next‐generation amplicon TRB locus sequencing can overcome limitations of flow‐cytometric Vβ expression analysis and confirms clonality in all T‐cell prolymphocytic leukemia cases

Contact Info

Product

Resources

About