Virulence Profiling of Listeria monocytogenes  Isolated from Different Sources

Thorat, S.R.; Rawool, Deepak B.; Sonkusale, P.M.; Warke, S.R.; Choudhari, S.P.; Kurkure, N.V.

doi:10.20546/ijcmas.2019.805.233

Cited by 4 publications

(4 citation statements)

References 12 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…LuxS and flaA genes were detected by multiplex PCR according to Thorat et al (2019) with some modifications in the cycling condition using LuxS primer sequence F: GGA AATGCCAGCGCTACACTCTTT and R: ATTGCATGCAGGAACTTC TGT CGC with 208 bp and flaA gene sequence F: GCGCAAGAACGTTTAG-CATCTGGT and R: TTGAGT AGCAGCACCTG-TAGCAGT with 363 bp. The PCR cycling condition was initial denatruation for 5 min at 95˚C, followed by 35 cycles at 94˚C for 15 sec, 1 min at 56˚C and 45 sec at 72˚C and final extension at 72˚C for 10 min.…”

Section: Detection Of Virulence Genes By Multiplex Pcrmentioning

confidence: 99%

See 1 more Smart Citation

Virulence Potential of Listeria monocytogenes Recovered from Ice cream and Aborted Women Samples in Sohag city, Egypt

Hassanien¹,

Shaker²

2021

AAVS

View full text Add to dashboard Cite

L isteria monocytogenes is a gram-positive bacterial pathogen which is considered as a ubiquitous in nature and can be isolated from the environmental sources, including water, soil, sewage, vegetables, and food (Soni et al., 2015). The main route of infection by L. monocytogenes is through ingestion of contaminated food, such as unpasteurized milk, milk products and raw unwashed vegetables (Rawool et al., 2016).L. monocytogenes causing several outbreaks after the consumption of milk and dairy products especially ice cream (Shamloo et al., 2019). Ice cream is considered one of the most dairy products that predominates interest of popu-

show abstract

Section: Detection Of Virulence Genes By Multiplex Pcrmentioning

confidence: 99%

“…The virulent strains of L. monocytogenes are responsible for major illness and several deaths in human and animals (Pournajaf et al, 2016). L. monocytogenes pathogenesis is enhanced by a group of virulence genes (Thorat et al, 2019). Internalins encoded by InlA and InlB are surface proteins mediating the bacteria attachment and entry inside the host cells.…”

mentioning

confidence: 99%

Virulence Potential of Listeria monocytogenes Recovered from Ice cream and Aborted Women Samples in Sohag city, Egypt

Hassanien¹,

Shaker²

2021

AAVS

View full text Add to dashboard Cite

show abstract

“…Recently, 23 putative L. monocytogenes isolates obtained from different sources, viz., food, animal, human, caterpillar, and mosquito, were screened for the presence of the virulence factors by multiplex polymerase chain reaction (mPCR). All strains harboured virulence genes ( plcA , hlyA , actA , prfA , inlC , inlJ , luxS and fla ) coequally irrespective of species of origin (Thorat et al ., 2019).…”

Section: Genetic Diversity and Virulence Of Recovered Isolates From D...mentioning

confidence: 99%

Ecology of Listeria monocytogenes and Listeria species in India: the occurrence, resistance to biocides, genomic landscape and biocontrol

Barbuddhe

Rawool

Doijad

et al. 2021

Environmental Microbiology

View full text Add to dashboard Cite

Summary Listeria monocytogenes, the causative agent of listeriosis, has been implicated in increasing foodborne outbreaks worldwide. The disease is manifested in various forms ranging from severe sepsis in immune‐compromised individuals, febrile gastroenteritis, still birth, abortions and meningoencephalitis. In India, data from studies on the detection and molecular epidemiological analysis of L. monocytogenes are only recently emerging. The presence of Listeria in different ecological niches has been recorded from India, including foods, soil, vegetables, mangrove swamps, seafood, freshwater fishes, clinical cases, and also insects. The organism has also been isolated from women with spontaneous abortions, miscarriage or recurrent obstetric history, aborted foetuses, animal clinical cases and wildlife samples. A novel species of Listeria has also been characterized. Listeria monocytogenes strains isolated from clinical, environmental, and foods showed biofilm‐forming abilities. Listeria monocytogenes serotype 4b isolates of ST328, a predominant and unique ST observed in India, was repeatedly isolated from different sources, times, and geographical locations. Here, we reviewed the occurrence of Listeria in different sources in India, its resistance to biocides, and provide epidemiological analysis on its genomic landscape.

show abstract

“…We hypothesise that Gram-positive bacteria use a different genomic mechanism that is not predicted well by our classifier. Listeria goaensis and Listeria monocytogenes have both been described as producing iridescent colonies (497,498), suggesting possible SC. Also, in the validation study we found apparent SC in swarming Paenibacillus vortex (Supplementary Table 4).…”

Section: Gram-positive Bacteria With Scmentioning

confidence: 99%

Surprising biology in uncharted microbial sequences

Meijenfeldt¹

View full text Add to dashboard Cite

The microbiome, all microorganisms in their natural habitat, can be collected on filters and its DNA extracted. Sequencing of this metagenome allows us to observe microorganisms not under a microscope or in the lab but via their DNA and in their natural habitat, revealing who they are and what they can do. Uncharted microbial sequences from the environment hold potential to change our view of the tree of life, by uncovering a vast microbial diversity that is not easily cultivated in the lab. Novel microorganisms with surprising biological traits await discovery in newly sequenced metagenomes. In addition, environmental sequences published by others are available in public databases, waiting to be further explored. The chapters of this thesis describe the search for unexpected biology in environmental sequences, both in newly sequenced datasets and in those already published. Reanalysis of already published datasets allows for comparisons between microbiomes from many different habitats, and for classical ecological questions to be addressed on the global scale. The chapters also describe the design of algorithms and tools to taxonomically annotate sequences from previously unknown microorganisms that are common in underexplored habitats and still surface in those more intensely studied like human-associated or marine habitats, and to use these annotations for an accurate and comprehensive view of the microbiome. Surprising biology is found deep down in the Black Sea, where elusive bacteria include archaeal-type lipids in their cell membrane, challenging a once-thought fundamental divide across the tree of life in the molecular composition of the membrane. Surprising biology is also found in the discovery of structural colour—the striking display of changing colours depending on the angle of observation—in the bacterial domain and in many different microbial habitats, including curiously the deep ocean where no light penetrates. By reanalysis of thousands of environmental sequencing studies across a wide range of habitats and geographical locations, the social niche breadth of microorganisms—the range of communities in which each lives—is quantified and ecological and genomic correlates of microbial specialism versus generalism are revealed. Together, the chapters paint a picture of a microbial world that is still largely left uncharted. With the development of new algorithms and tools, and the (re)analysis of large-scale data, this thesis uncovers a fraction of that vast microbial unknown.

show abstract

Virulence Profiling of Listeria monocytogenes Isolated from Different Sources

Cited by 4 publications

References 12 publications

Virulence Potential of Listeria monocytogenes Recovered from Ice cream and Aborted Women Samples in Sohag city, Egypt

Virulence Potential of Listeria monocytogenes Recovered from Ice cream and Aborted Women Samples in Sohag city, Egypt

Ecology of Listeria monocytogenes and Listeria species in India: the occurrence, resistance to biocides, genomic landscape and biocontrol

Surprising biology in uncharted microbial sequences

Contact Info

Product

Resources

About