Watermelon-infesting Tephritidae fruit fly guild and parasitism by Psyttalia phaeostigma (Hymenoptera: Braconidae)

Abstract

An ecological guild of Tephritidae fruit flies exploits cucurbit vegetable fruits, tremendously reducing their production worldwide. Knowledge of the composition of the guild of infesting flies in the field and information on their natural enemy species, might improve pest management strategies. Our aim was therefore to identify Tephritidae species infesting the watermelon Citrullus lanatus (Thunb.) Matsum. & Nakai in the Republic of Benin. Morphological and molecular identification of parasitoid species present in the field collections was also done. Infested watermelons were sampled in one of the main watermelonproduction areas in the country. Adult tephritid flies emerging from watermelons were identified as Dacus bivittatus (Bigot), D. ciliatus Loew, D. punctatifrons Karsch, D. vertebratus Bezzi, Zeugodacus cucurbitae (Coquillet), and Ceratitis cosyra (Walker). In this study period, D. vertebratus was consistently the most abundant species emerging from watermelon. Dacus ciliatus was the second most common species followed by Z. cucurbitae. The number of emerging fruit flies per kilogram of watermelon varied with collection date and month, and was most variable for D. vertebratus. Parasitism in the fruit flies was 1.6 ± 6.4% and occurred through one wasp species that was identified as Psyttalia phaeostigma Wilkinson (Hymenoptera: Braconidae). This solitary parasitoid is closely related to other members of the P. concolor species complex, some of which are used in biological control. Problems associated with identifying Psyttalia species and possibility of using this wasp as a biological control agent against tephritid flies were discussed.

Bioefficacy of Isolates of Beauveria bassiana (Balsamo) Vuillemin and Metarhizium anisopliae (Metschnikoff) (Ascomycota: Hypocreales) as field Protectants of Citrullus lanatus (Thunb.) Matsum. and Nakai against Fruit Flies

“…Fruit flies represent the most notorious pests of economic importance on cucurbit. , They are responsible of damaging large quantities of fruits and vegetables grown in the tropics. ,, The most prominent and common fruit fly species infesting cucurbit fruit in Sub-Saharan Africa especially watermelon are D. acus vertebratus (Bezzi), D. bivittatus (Bigot), D. punctatifrons (Karsch), D. frontalis (Becker), D. lounsburyii (Coquillet), D. ciliatus (Loew) and Zeugodacus cucurbitae ( Coquillett). − In Benin, D. vertebratus is reported as the most dominant species and causes up to 80% yield losses . A recent study in ref in Southern Benin also revealed that D. vertebratus was the predominant species constituting 65% of the 17,665 Tephritid adults observed. Zeugodacus cucurbitae prefers watermelon, pumpkin and cucumber and can cause up to 100% loss in an unprotected crop .…”

“…13−17 In Benin, D. vertebratus is reported as the most dominant species and causes up to 80% yield losses. 18 A recent study in ref 19 in Southern Benin also revealed that D. vertebratus was the predominant species constituting 65% of the 17,665 Tephritid adults observed. Zeugodacus cucurbitae prefers watermelon, pumpkin and cucumber and can cause up to 100% loss in an unprotected crop.…”

“…Producers/growers have used several control methods to manage fruit flies including chemical control, monitoring with attractants, cultural control (field sanitation, fruit bagging, prompt fruit harvest, postharvest treatment), soil inoculation, release of natural enemies, and release of sterile insects. ,,, In most cases, growers have resorted to extreme use of pesticides such as K-Optimal and Pacha to overcome the losses caused by tephritid fruit flies. ,, This has led to adverse effects on both pests and beneficial insect as well as the environment and human being’s health . It is therefore important to investigate more sustainable alternative control approaches against these pests.…”

Identification, Microhabitat, and Ecological Niche Prediction of Two Promising Native Parasitoids of Tuta absoluta in Kenya

“…To obtain high DNA quality, the heads of the parasitoids were excised before extraction according to the protocol of Livak, [ 45 ]. For the polymerase chain reaction (PCR) amplification, a Master Mix solution was prepared by mixing the barcoding primers LCO1490 (5′GGTCAACAAATCATAAAGATATTGG3′), and HCO2198 (5′TAAACTTCAGGGTGACCAAAAAATCA) for arthropods identification [ 46 ], DDH2O and hot start. Each sample was prepared with a 48 µL master mix solution in a PCR tube and 2 µL of DNA was added to the solution.…”

“…The tomato production system was also recorded as either an open field or greenhouse/screen house production. Additionally, an average number of N. tenuis per kilogram of tomato leaves were estimated and four classes were obtained for this variable 0 = absence of N. tenuis , [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 ] = low-level presence of N. tenuis , [ 50 ,…”