Wild and attenuated vaccine RS-12 strains of mumps virus exhibit differences in amino acid sequences of their proteins

Abstract

Summary. -Attenuated mumps virus (MuV) RS-12 strain-based vaccine is one of several effective vaccines available in the prevention of mumps. Since previous studies have unveiled only about one-third of the attenuated vaccine RS-12 strain genome sequence, the rest of sequence and molecular basis for attenuation remained unsolved. Therefore, in this study, the full-length genome sequences of wild and attenuated RS-12 strains were determined and compared. The comparison revealed nucleotide substitutions at 9 positions leading to amino acid substitutions at 6 positions in P, V, I, M, and L proteins, while the remaining substitutions were silent. This result indicates that the observed mutations in P, V, I, M, and L proteins of MuV might be responsible for the attenuation of the RS-12 vaccine strain.

Isolation and Characterization of a Discrete Genetically Homogeneous Viral Subpopulation of Mumps Virus RS-12 Strain with Superior Oncolytic Potency Compared to Its Progenitor Virus

“…The MuV vaccine strains are generally a mixture of genetic mutants in the same strain. Genetic heterogeneity has been observed in different MuV strain-based vaccines (17,(31)(32)(33)(34)(35)(36) due to several factors, especially the absence of a proofreading mechanism by the RNA-dependent RNA polymerase (RdRP) during viral genome replication. According to Figure 1B, the chromatogram showed that the parental vaccine seed exhibited two peaks at nucleotide positions 1591, 2417, 3774, and 12977, indicating the presence of at least two different viral subpopulations.…”

“…The virus was isolated in green monkey kidney cells (GMKCs) and underwent several passages at a low temperature in normal hu-man diploid cells (MRC-5), producing an attenuated phenotype. Further analyses showed that this strain belonged to the MuV genotype H (16), and subsequently, the presence of at least two viral subpopulations was identified in this strain (17). The RS-12 strain is adapted to human diploid cells and grows optimally in normal diploid cells, such as MRC-5.…”

“…The synthesized cDNA was used as a template in the polymerase chain reaction (PCR) assay, as previously described (17). Briefly, the PCR reactions were performed in the Mastercycler ® Thermal Cycler (Eppendorf, Hamburg, Germany), using three primer pairs: Forward primer MuP1452+ (TGGAGGAATCAGATGACG)/reverse primer MuP3274-(GAGGAATTTTGATCTGTG); Forward primer MuM-2720+ (GGTGACCCAAATAAAGAATG)/reverse prime MuM-4122-(TGTGACCGCCTGCATGGA); and Forward primer MuL-12164+ (GTATCACTTAAATCAGCACTC)/reverse prime MuL-13713-(CTTGGGAGAGAGTATTTC).…”